Alysicarpus monilifer

(L.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Alysicarpus

At a glance

Occurrence records199

Data sources10

Biological traits20

DNA specimens6

eDNA detections6

Sources10 archives

Databases and archives Alysicarpus monilifer's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Alysicarpus monilifer là một loài thực vật có hoa trong họ Đậu. Loài này được (L.) DC. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology3

Seed mass2.79 mg

Seed mass max2.79 mg

Seed mass min2.79 mg

Life cycle & reproduction5

Dispersal typeanimal

Life formannual, perennial or subshrub

Life spanperennial

⚠ sources differ — AusTraits: perennial · GIFT: annual

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formherb

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Alysicarpus monilifer across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cholestane steroids $ Stigmastane steroids2

Ursane and Taraxastane triterpenoids1

Simple phenolic acids1

Usnic acid and derivatives1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
3-Hydroxybenzoic acid	present	LOTUS
Poriferasterol	present	LOTUS
Stigmasterol	present	LOTUS
Usnic Acid	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alysicarpus monilifer has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN176382.1 ↗510 bp

ACGT

TGTCGATTGCCCGAACCAGTTTGACCGGCGAACGTGTTTATCTAAGCAACGGGGGATGGCATGATCTCATCCTCCCCCGGCGCCGAGAGG …

Alysicarpus monilifer strain ITS1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alysicarpus monilifer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1616×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +2

CCDB · ipcn-api-dl — Sidhu, M. & S. S. Bir. 1983. Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1–13.

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.

CCDB · ipcn-api-dl — Sinha, R. P. & K. A. Chandra. 1991. Karyotypic analysis in Alysicarpus species. Proc. Indian Sci. Congr. Assoc. 78(3,VIII): 129–130.

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1978. Cytology of the genus Alysicarpus Neck. ex Desv. (Fabaceae). Cytologia 43: 35–44.

CCDB · ipcn-api-dl — Sareen, T. S. & R. TREHAN. 1977. Cytological studies in some Papilionaceae. Proc. Indian Sci. Congr. Assoc. 64. 156.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · book-ipcn75-78 — Sareen & Trehan 1977

CCDB · book-ipcn75-78 — Bir & Kumari 1977

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1978

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1976

CCDB · book-ipcn73-74 — BHATT, R.P. 1974. Studies on the flora in north Gujarat. III Cytolog I Nucleus 17: 33-39. !

CCDB · book-indian_vol1 — Rao, H.K.S 1954; Bir, S.S. & Sidhu, S. 1966, 1967 ; Bhatt, R.P. 1974 ; Sanjappa, M. & Bhatt, R.P. 1976, 1978 ; Sareen, T.S. & _Trehan, R. 1977 ; Bir, S.S. & Sidhu, M. 1980

CCDB · book-fedorov — Rao H. K. 1954

CCDB · book-fedorov — Bir, Sidhu (C. n. VI.. 1966)

n 812×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +1

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1982. Chromosome numbers of some plants of Pakistan. Pakistan J. Bot. 14: 117–129.

CCDB · ipcn-api-dl — Perveen, S. & S. Khatoon. 1989. Chromosome numbers in Papilionaceae from Pakistan. Pakistan J. Bot. 21: 247–251.

CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.

CCDB · ipcn-api-dl — Jahan, B., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in some taxa of Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gard. 81: 792–799.

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1978. Cytology of the genus Alysicarpus Neck. ex Desv. (Fabaceae). Cytologia 43: 35–44.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn66 — Bir &Sidhu 1966

CCDB · book-ipcn67-71 — BIR, S.S. & S. SIDHU. 1967. Cytological observations on the North Indian members of family Leguminosae. Nucleus 10: 47-63.

CCDB · book-ipcn75-78 — Bir & Kumari 1977

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type199 records

Wild obs. + sensor100

Museum / vouchered63

Cultivated / captive9

Other27

Origin

Introduced1

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 3≤1 km 13≤10 km 45>10 km 6

67 georeferenced · 33 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 2≤10 km 4

8 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence63

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	21
Kew, GB	8
Pondicherry, IN	8
Xiamen, CN	3
Kunming, CN	3
Saint Louis, US	3
Brisbane, AU	2
Baroda, IN	2
Gujarat Biodiversity Gene Banklocation not on record	2
Bronx, US	1
Plocation not on record	1
MeiseBGlocation not on record	1
Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record	1
Dehra Dun, IN	1
SNJB's KKHA Arts, SMGL Commerce & SPHJ Science College Chandwad, Dist. Nashik, Maharashtra, India. 423101.location not on record	1
Uppsala, SE	1
Qarshi Botanical Gardenlocation not on record	1
València, ES	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1

19 institutions · 62 of 63 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Alysicarpus monilifer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 28.1–28.1

Seasonal swing summer↔winter12.9 °C

Max temp (day)31.4 °C 30.7–32.1

Min temp (night)24.4 °C 23.9–24.8

Precipitation181 mm/mo 121–241

Air humidity63.1 % 61.7–64.5

Moisture balance34.8 mm/mo -28.6–98.2

Vapour deficit1,403 Pa 1,352–1,455

Wind speed3.00 m/s 2.90–3.10

Cloud cover14.6 % 7.90–21.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)