Alysicarpus bupleurifolius

(L.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Alysicarpus

At a glance

Occurrence records357

Data sources11

Biological traits14

DNA specimens7

eDNA detections7

Sources11 archives

Databases and archives Alysicarpus bupleurifolius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility357 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources14 traits

Chemical compositionNPASS5 compounds

Occurrence & distributionGBIF357 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 16

01Narrative

柴胡叶链荚豆（学名：），又名長葉煉莢豆，为豆科链荚豆属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology1

Seed mass1.29 mg

Life cycle & reproduction3

Life formannual or perennial

Life spanannual

⚠ sources differ — AusTraits: annual · GIFT: perennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Alysicarpus bupleurifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cinnamic acids and derivatives $ Phenylethanoids4

Iridoids monoterpenoids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
Cistanoside D	present	NPASS
Leucosceptoside A	present	NPASS
Plantarenaloside	present	NPASS
Poliumoside	present	NPASS
Verbascoside	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alysicarpus bupleurifolius has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY702666.1 ↗272 bp

ACGT

AAGGATCATTGTCGATTGCCCGAAACCAGTTTGACCGGCGAACGCGTTTATCTAAGCCACGGGGGATGGCATGATCTCATCCTCCCCCGG …

Alysicarpus bupleurifolius voucher A.F.G. Kerr 16207, 1928 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alysicarpus bupleurifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode20records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1620×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +3

CCDB · ipcn-api-dl — Sidhu, M. 1981. Cytopalynological studies on weed flora of cultivable lands of Patiala District (Punjab). Proc. Indian Sci. Congr. Assoc. 68 (Sect. VI): 47.

CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.

CCDB · ipcn-api-dl — John, C. K., R. J. Thengane & S. H. Tulpule. 1985. A post pachytene diffuse stage in Alysicarpus rugosus DC. Curr. Sci. 54: 938–939.

CCDB · ipcn-api-dl — Sidhu, M. & S. S. Bir. 1983. Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1–13.

CCDB · ipcn-api-dl — Sinha, R. P. & K. A. Chandra. 1991. Karyotypic analysis in Alysicarpus species. Proc. Indian Sci. Congr. Assoc. 78(3,VIII): 129–130.

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1985. Chromosomal studies on the Indian legumes. In: V. R. Reddi & M. K. Rao (editors), Cytogenetics of Higher Plants: Chromosome Structure and Behaviour. pp. 39–41.

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.

CCDB · book-ipcn75-78 — Bir & Kumari 1977

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1976

CCDB · book-ipcn73-74 — BHATT, R.P. 1974. Studies on the flora in north Gujarat. III Cytolog I Nucleus 17: 33-39. !

CCDB · book-indian_vol1 — Rao, H.K.S. 1954 ; Bir,-S.S. & Sidhu, S, 1966, 1967 ; Mehra, P.N. & Dha- wan, H. 1971 ; Bhatt, R.P. 1974 ; Sanjappa, M. & Bhatt, R.P. 1976 ; Bir, S.S. & Sidhu, M. 1980

CCDB · book-indian_vol1 — Bir, S.S. & Kumari, S. 1978a

CCDB · eflora

CCDB · book-fedorov — Rao H. K. 1954

CCDB · book-fedorov — Bir, Sidhu (C. n. VI. 1966)

n 88×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +1

CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.

CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · book-ipcn66 — Bir &Sidhu 1966

CCDB · book-ipcn67-71 — BIR, S.S. & S. SIDHU. 1967. Cytological observations on the North Indian members of family Leguminosae. Nucleus 10: 47-63.

CCDB · book-ipcn67-71 — MEHRA, P.N. & H. DHAWAN. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-79""'1":

CCDB · book-ipcn75-78 — Bir & Kumari 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type357 records

Wild obs. + sensor40

Museum / vouchered278

Cultivated / captive8

Other31

Origin

Native10

Introduced3

Range

Area of Occupancy AOO980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 4≤1 km 2≤10 km 6>10 km 9

21 georeferenced · 19 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 39≤1 km 11≤10 km 44>10 km 35

129 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence278

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	70
Kew, GB	21
Taipei, TW	21
Museo Entomologico de Leonlocation not on record	9
Smithfield, AU	8
Xiamen, CN	8
Canberra, AU	7
TAIElocation not on record	7
Guangzhou, CN	6
Paris, FR	5
Guilin, CN	5
James Cook Townsvillelocation not on record	5
Palmerston, AU	4
Moscow State Universitylocation not on record	4
Mount Annan, AU	4
Bronx, US	3
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	2
Taipei, TW	2
Kunming, CN	2
Cambridge University Herbariumlocation not on record	2
Honolulu, US	2
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	2
Yunnan Universitylocation not on record	2
SNJB's KKHA Arts, SMGL Commerce & SPHJ Science College Chandwad, Dist. Nashik, Maharashtra, India. 423101.location not on record	2
CASlocation not on record	1
Beijing, CN	1
Stockholm, SE	1
GAlocation not on record	1
LDlocation not on record	1
Taipei, TW	1
Edinburgh, GB	1
Burlington, US	1
BISHlocation not on record	1
Université du Lomélocation not on record	1
Dehra Dun, IN	1

35 institutions · 214 of 278 vouchered records shown · 64 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Alysicarpus bupleurifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)