Alysia manducator

(Panzer, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Alysia

At a glance

Occurrence records227

Data sources6

Biological traits0

DNA specimens27

eDNA detections29

Sources6 archives

Databases and archives Alysia manducator's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility227 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF227 records

Environmental DNA4 datasets · 9 countries29 detections

DNA & barcodingBOLD27 specimens

01Narrative

Alysia manducator is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Panzer in 1799.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alysia manducator has left across the world's sequence archives.

At a glance

DNA specimens27

BINs5

Marker genes1

eDNA detections29

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

4Amostly conserved

13Tmostly conserved

16Gmostly conserved

34Amostly conserved

40Tmostly conserved

56Tmostly conserved

76Amostly conserved

79Gmostly conserved

85Tmostly conserved

88Gmostly conserved

91Amostly conserved

176Amostly conserved

178Cmostly conserved

190Amostly conserved

208Gmostly conserved

214Amostly conserved

241Tmostly conserved

277Amostly conserved

298Amostly conserved

316Gmostly conserved

322Amostly conserved

334Cmostly conserved

337Gmostly conserved

416Gmostly conserved

483Amostly conserved

496Gmostly conserved

499Tmostly conserved

559Amostly conserved

616Tmostly conserved

622Gmostly conserved

625Gmostly conserved

628Tmostly conserved

631Tmostly conserved

653Cmostly conserved

GGTATTATATTTTTTGTTTGGAATTTGGGCAGGAATAGTTGGATTATCCATAAGGTTAATTATTCGTTTAGAATTAGGGATACCTGGGGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes4

BINs5

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alysia alticolasame genus7.6%Alysia incongruasame genus8.8%Chorebus laridessame family9.9%Biosteres punctiscutasame family10.0%Orthostigma mandibularesame family10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type227 records

Wild obs. + sensor43

Museum / vouchered184

Origin

Introduced125

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 16≤1 km 17≤10 km 4>10 km 1

38 georeferenced · 5 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 3≤1 km 48≤10 km 21

72 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence184

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	125
Bonn, DE	19
New Zealand Arthropod Collectionlocation not on record	12
MZLUlocation not on record	6
UVEG-ENVlocation not on record	3
Auckland, NZ	3
Stockholm, SE	2
Helsinki, FI	2
SLU Artdatabankenlocation not on record	2
South Kensington, GB	2
Sydney, AU	2
National Museums Scotlandlocation not on record	1
Tromsø, NO	1
Natural History Museum Rotterdamlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Chicago, US	1
Bavarian State Collection of Zoologylocation not on record	1

17 institutions · 184 of 184 vouchered records shown

09Environmental DNA29 detections

Where the DNA of Alysia manducator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys4

Countries9

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map9 countries0

Garden, coast and birch habitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 9.80–17.5

Seasonal swing summer↔winter15.4 °C

Max temp (day)17.6 °C 13.0–20.5

Min temp (night)10.9 °C 6.80–15.0

Precipitation83.7 mm/mo 57.4–122

Air humidity61.8 % 58.7–66.4

Moisture balance-24.2 mm/mo

Vapour deficit610 Pa 435–768

Wind speed4.10 m/s

Cloud cover43.3 % 36.6–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)