Alypiodes bimaculata

Herrich-Schäffer, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Alypiodes

At a glance

Occurrence records454

Data sources7

Biological traits0

DNA specimens7

eDNA detections9

Sources7 archives

Databases and archives Alypiodes bimaculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility454 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF454 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD7 specimens

01Narrative

Alypiodes bimaculata, the two-spotted forester, is a species of moth in the family Noctuidae (the owlet moths). The species was first described by Gottlieb August Wilhelm Herrich-Schäffer in 1853. It is found in North America. The MONA or Hodges number for Alypiodes bimaculata is 9312.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alypiodes bimaculata has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

5Gvariable

7Avariable

61Amostly conserved

349Tvariable

TTTTGGAATTTGATCTGGAATAGTAGGAACCTCCCTTAGATTATTAATTCGAGCAGAATTAGGCATACCTGGATCTTTAATTGGAGATGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes4

BIN1

Most divergent pair0.47%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alypiodes geronimosame genus5.6%Agaristodes feisthameliisame family6.1%Neotuerta sabulosasame family6.2%Phalaenoides glycinaesame family6.4%Gerra radicalissame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type454 records

Wild obs. + sensor407

Museum / vouchered47

Range

Area of Occupancy AOO1 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 187≤1 km 81≤10 km 46>10 km 12

326 georeferenced · 81 without coordinates

Open the mapobservation + sensor407

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 3≤10 km 35>10 km 3

41 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	18
East Lansing, US	11
New Haven, US	5
Ciudad de México, MX	3
Philadelphia, US	2
OSUClocation not on record	2
Albuquerque, US	1
Denver, US	1
St. Paul, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Chicago, US	1

11 institutions · 46 of 47 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Alypiodes bimaculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 22.9–24.7

Seasonal swing summer↔winter17.4 °C

Max temp (day)30.4 °C 29.6–31.0

Min temp (night)17.9 °C 16.9–18.8

Precipitation133 mm/mo 133–143

Air humidity51.1 % 50.2–54.3

Moisture balance-39.0 mm/mo -39.0–-23.2

Vapour deficit1,461 Pa 1,282–1,563

Wind speed2.20 m/s 2.00–2.30

Cloud cover15.7 % 15.7–18.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)