Alypia wittfeldii

H.Edwards, 1883 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Alypia

At a glance

Occurrence records402

Data sources7

Biological traits0

DNA specimens5

eDNA detections2

Sources7 archives

Databases and archives Alypia wittfeldii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility402 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF402 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Alypia wittfeldii, or Wittfeld's forester, is a moth of the family Noctuidae. The species was first described by Henry Edwards in 1883. It is found in the United States in almost all of Florida (except the western panhandle of the state), coastal Georgia, and South Carolina. The length of the forewings is 13–14 mm. Adults are on wing from January to April in southern Florida and mostly in April along the coasts of South Carolina and Georgia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alypia wittfeldii has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

508Gvariable

616Cvariable

AACATTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACTTCTCTTAGACTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mimeusemia simplexsame family4.4%Mimeusemia centralissame family4.6%Neotuerta sabulosasame family5.5%Euscirrhopterus klagesisame family5.8%Phalaenoides glycinaesame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type402 records

Wild obs. + sensor350

Museum / vouchered52

Range

Area of Occupancy AOO1 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 168≤1 km 62≤10 km 22>10 km 39

291 georeferenced · 59 without coordinates

Open the mapobservation + sensor350

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 7≤10 km 14>10 km 7

28 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	25
Washington, US	20
East Lansing, US	2
University of Central Floridalocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

7 institutions · 52 of 52 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Alypia wittfeldii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 18.0–18.0

Seasonal swing summer↔winter15.5 °C

Max temp (day)20.5 °C

Min temp (night)15.9 °C

Precipitation84.7 mm/mo

Air humidity57.8 %

Moisture balance-72.8 mm/mo

Vapour deficit865 Pa

Wind speed5.90 m/s

Cloud cover46.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)