Alviniconcha hessleri

Okutani & Ohta, 1988 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Paskentanidae/Alviniconcha

At a glance

Occurrence records262

Data sources8

Biological traits2

DNA specimens154

eDNA detections154

Sources8 archives

Databases and archives Alviniconcha hessleri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility177 records↗

OBISOcean Biodiversity Information System85 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI154 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics154 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS262 records

Environmental DNA1 datasets · 2 countries154 detections

DNA & barcodingBOLD154 specimens

Genome at a glanceGoaT · NCBI919 Mbp

01Narrative

Alviniconcha hessleri is een slakkensoort uit de familie van de Paskentanidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1988 door Okutani & Ohta.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding154 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alviniconcha hessleri has left across the world's sequence archives.

At a glance

DNA specimens154

BINs2

Marker genes4

eDNA detections154

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P504 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

19Cmostly conserved

120Cmostly conserved

138Tmostly conserved

156Tmostly conserved

168Gmostly conserved

372Amostly conserved

GGGTTAGTTGGTACAGCCCTAAGTCTTCTAATTCGAGCCGAATTAGGACAGCCTGGAGCACTATTAGGTGACGATCAACTTTATAATGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes36

BINs2

Most divergent pair3.4%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alviniconcha kojimaisame genus4.4%Alviniconcha strummerisame genus9.1%Alviniconcha marisindicasame genus11.1%Alviniconcha adamantissame genus13.1%Struthiolaria papulosasame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alviniconcha hessleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size919 320 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alviniconcha hessleri0.92 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness81.8% BUSCO

08Occurrence & distribution

Record type262 records

Wild obs. + sensor4

Museum / vouchered242

Other16

Range

Area of Occupancy AOO408 km²

Depth

0–200 m sunlit0

200–1000 m twilight1

1–4 km midnight60

>4 km abyssal0

median 2 625.3 m · max 3 650 m · 61 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 37≤1 km 2

39 georeferenced · 203 without coordinates

Open the institutions mapphysical evidence242

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	18
Santa Barbara Museum of Natural Historylocation not on record	5
Cambridge, US	3
University of Victorialocation not on record	2
Denver, US	1
Frankfurt am Main	1

6 institutions · 30 of 242 vouchered records shown · 138 without an institution code

09Environmental DNA154 detections

Where the DNA of Alviniconcha hessleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found154

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 154 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 26.6–27.0

Seasonal swing summer↔winter2.10 °C

Max temp (day)27.6 °C 27.2–27.6

Min temp (night)26.0 °C 25.9–26.1

Precipitation171 mm/mo 134–187

Air humidity62.9 % 62.3–63.3

Vapour deficit1,308 Pa 1,303–1,311

Cloud cover34.3 % 33.7–36.2

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)