Alvania compacta

(P.P.Carpenter, 1864) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Rissoidae/Alvania

At a glance

Occurrence records403

Data sources6

Biological traits2

DNA specimens28

eDNA detections62

Sources6 archives

Databases and archives Alvania compacta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility233 records↗

OBISOcean Biodiversity Information System170 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS403 records

Environmental DNA1 datasets · 2 countries62 detections

DNA & barcodingBOLD28 specimens

01Narrative

Alvania compacta is een slakkensoort uit de familie van de Rissoidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1864 door Carpenter.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alvania compacta has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes2

eDNA detections62

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 87 variable positions, in barcode order

7Gmostly conserved

13Avariable

16Tmostly conserved

28Tmostly conserved

31Cvariable

34Amostly conserved

43Gmostly conserved

46Avariable

49Amostly conserved

52Gmostly conserved

58Amostly conserved

67Tmostly conserved

73Tmostly conserved

82Cmostly conserved

97Amostly conserved

100Cmostly conserved

111Gmostly conserved

112Tmostly conserved

118Avariable

123Gvariable

124Tmostly conserved

126Amostly conserved

139Tmostly conserved

151Amostly conserved

154Amostly conserved

163Cmostly conserved

166Tmostly conserved

169Cmostly conserved

172Tmostly conserved

174Gvariable

196Amostly conserved

220Amostly conserved

226Cmostly conserved

229Tmostly conserved

231Amostly conserved

241Amostly conserved

256Tmostly conserved

258Amostly conserved

259Cmostly conserved

262Amostly conserved

277Amostly conserved

283Amostly conserved

289Gmostly conserved

295Amostly conserved

307Tmostly conserved

313Amostly conserved

316Amostly conserved

319Amostly conserved

328Tmostly conserved

331Tmostly conserved

334Tmostly conserved

337Amostly conserved

352Gmostly conserved

370Cmostly conserved

373Cmostly conserved

381Amostly conserved

382Gmostly conserved

385Tmostly conserved

388Gmostly conserved

415Tmostly conserved

417Amostly conserved

418Cmostly conserved

436Gmostly conserved

439Amostly conserved

442Tmostly conserved

447Amostly conserved

448Cmostly conserved

453Gvariable

454Avariable

463Cmostly conserved

466Amostly conserved

487Cmostly conserved

490Tmostly conserved

493Tmostly conserved

499Tmostly conserved

505Amostly conserved

526Gmostly conserved

553Gmostly conserved

559Tmostly conserved

568Tmostly conserved

580Tmostly conserved

586Tmostly conserved

604Gmostly conserved

607Tmostly conserved

625Amostly conserved

634Cvariable

640Amostly conserved

AAATAAGTGTTGATATAAAATAGGATCTCCCCCACCTGCAGGGTCAAAAAAGGCAGTATTTAAATTTCGATCTGTTAAAAGCATAGTAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes11

BINs2

Most divergent pair9.7%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Onoba carpenterisame family12.9%Burnupena papyraceasame order14.0%Anachis raysutanasame order14.1%Struthiolaria papulosasame order15.3%Lacuna variegatasame order15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S

animal barcodemarker

08Occurrence & distribution

Record type403 records

Wild obs. + sensor51

Museum / vouchered345

Fossil1

Other6

Range

Area of Occupancy AOO776 km²

Depth

0–200 m sunlit137

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 19.6 m · max 150 m · 137 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 49 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 4≤10 km 29>10 km 6

39 georeferenced · 306 without coordinates

Open the institutions mapphysical evidence345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	32
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	22
Edmonton, CA	20
Cambridge, US	10
CASlocation not on record	10
Washington, US	10
Victoria, CA	9
Hakai Institutelocation not on record	8
Philadelphia, US	6
Florida Museum of Natural Historylocation not on record	4
Chongqing Museumlocation not on record	3
Champaign, US	2
Denver, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Ann Arbor, US	1
Delaware Museum of Nature and Sciencelocation not on record	1

16 institutions · 140 of 345 vouchered records shown · 84 without an institution code

09Environmental DNA62 detections

Where the DNA of Alvania compacta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

rocky reef, Macrocystis pyrifera forestRock Outcropsand, seagrass beddockmarine benthic biomewater column

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.90 °C 8.40–18.2

Seasonal swing summer↔winter15.7 °C

Max temp (day)13.2 °C 12.2–22.2

Min temp (night)4.20 °C 4.20–13.8

Precipitation109 mm/mo 65.4–144

Air humidity63.2 % 59.6–65.8

Moisture balance23.7 mm/mo

Vapour deficit420 Pa 420–758

Wind speed3.90 m/s

Cloud cover45.6 % 33.8–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)