Alucita phricodes

Meyrick, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Alucitidae/Alucita

At a glance

Occurrence records561

Data sources8

Biological traits0

DNA specimens27

eDNA detections25

Sources8 archives

Databases and archives Alucita phricodes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility561 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF561 records

Environmental DNA1 datasets · 1 countries25 detections

DNA & barcodingBOLD27 specimens

01Narrative

Alucita phricodes is a species of moth of the family Alucitidae. It is found from the Atherton Tableland in Queensland to Batemans Bay in New South Wales. The wingspan is about 10 mm. The larvae feed on the buds and flowers of Pandorea jasminoides and Pandorea pandorana.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alucita phricodes has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes3

eDNA detections25

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TACTTTATATTTTATTTTTGGAATTTGAGCTGGATTATTAGGTACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes4

BIN1

Most divergent pair0.30%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Satole ligniperdalissame order9.4%Chrysolarentia argodesmasame order9.9%Xanthorhoe pseudogaliatasame order10.0%Chrysolarentia actiniphasame order10.0%Xanthorhoe skouisame order10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCYTB

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type561 records

Wild obs. + sensor554

Museum / vouchered7

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 253≤1 km 156≤10 km 7>10 km 21

437 georeferenced · 117 without coordinates

Open the mapobservation + sensor554

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	3
Australian National Insect Collectionlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1

3 institutions · 6 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA25 detections

Where the DNA of Alucita phricodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 18.4–22.8

Seasonal swing summer↔winter8.60 °C

Max temp (day)24.1 °C 23.8–27.2

Min temp (night)18.9 °C 13.7–20.9

Precipitation105 mm/mo 17.6–129

Air humidity61.6 % 58.2–62.4

Moisture balance-30.1 mm/mo

Vapour deficit1,033 Pa 882–1,101

Wind speed2.60 m/s

Cloud cover25.6 % 18.7–28.1

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)