Alucita huebneri

Wallengren, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Alucitidae/Alucita

At a glance

Occurrence records226

Data sources8

Biological traits0

DNA specimens25

eDNA detections21

Sources8 archives

Databases and archives Alucita huebneri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 6 countries21 detections

DNA & barcodingBOLD25 specimens

01Narrative

Alucita huebneri is a moth of the family Alucitidae. It is found in most of Europe, except Ireland, Great Britain, the Benelux, Fennoscandia, Latvia, the Baltic region, Ukraine and Slovenia.Fauna Europaea The habitat consists of mesotrophic meadows, colline and montane hay meadows on altitudes between 200 and 400 metres. The wingspan is about 15 mm. Adults are on wing from May to June and in September. The larvae feed on Scabiosa, Centaurea and Knautia species. They live within the flowers and on seeds of their host plant.Provisional atlas and checklist of the Alucitidae fauna of Hungary (Lepidoptera)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alucita huebneri has left across the world's sequence archives.

At a glance

DNA specimens25

BINs2

Marker genes1

eDNA detections21

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

10Tmostly conserved

109Amostly conserved

118Tmostly conserved

160Amostly conserved

197Cmostly conserved

217Gmostly conserved

235Cmostly conserved

313Tmostly conserved

364Cmostly conserved

445Tmostly conserved

508Gmostly conserved

533Cmostly conserved

535Gmostly conserved

536Cmostly conserved

547Tmostly conserved

562Amostly conserved

646Cmostly conserved

TACATTATATTTTATTTTCGGAATTTGAGCTGGTTTATTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes8

BINs2

Most divergent pair2.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alucita cancellatasame genus6.2%Alucita grammodactylasame genus7.0%Alucita montanasame genus7.8%Alucita lalanneisame genus9.1%Perimeceta leucoselenesame order9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor203

Museum / vouchered4

Other19

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 84≤1 km 41≤10 km 49>10 km 4

178 georeferenced · 25 without coordinates

Open the mapobservation + sensor203

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	2
Durban Natural Science Museumlocation not on record	1
East Lansing, US	1

3 institutions · 4 of 4 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Alucita huebneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map6 countries0

dry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 12.2–20.8

Seasonal swing summer↔winter20.9 °C

Max temp (day)20.8 °C 16.0–24.4

Min temp (night)10.4 °C 5.80–14.6

Precipitation101 mm/mo 71.5–145

Air humidity58.3 % 56.8–59.7

Moisture balance-24.5 mm/mo -47.0–42.4

Vapour deficit772 Pa 584–988

Wind speed2.50 m/s 1.30–2.90

Cloud cover37.1 % 34.4–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)