Alticus simplicirrus

Smith-Vaniz & Springer, 1971 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Blenniidae/Alticus

At a glance

Occurrence records45

Data sources10

Biological traits4

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Alticus simplicirrus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

OBISOcean Biodiversity Information System12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS45 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Alticus simplicirrus, the Marquesan rockstripper, is a species of combtooth blenny found in the central Pacific ocean, around the Marquesas Islands. This species reaches a length of 3.7 cm SL.Alticus simplicirrus at www.fishbase.org. A population of blennies of this or a related species on Rarotonga has evolved to become largely terrestrial, apparently at least in part as a way of avoiding marine predators.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alticus simplicirrus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

22Cmostly conserved

541Amostly conserved

CCTCTATTTAATTTTCGGTGCCTGAGCCGGGATGGTAGGTACGGCCCTTAGCTTACTTATCCGAGCAGAGTTAAGCCAACCCGGAGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.31%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Istiblennius bellussame family15.1%Blenniella bilitonensissame family15.3%Istiblennius edentulussame family15.4%Opistognathus whitehurstisame order16.4%Jaydia striatasame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type45 records

Wild obs. + sensor10

Museum / vouchered35

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 6≤1 km 1≤10 km 3

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 2≤1 km 6≤10 km 3>10 km 2

13 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	13
CASlocation not on record	3
Unknownlocation not on record	2
FishBaselocation not on record	1

4 institutions · 19 of 35 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Alticus simplicirrus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 22.6–26.1

Seasonal swing summer↔winter1.30 °C

Max temp (day)26.5 °C 23.2–26.7

Min temp (night)25.2 °C 21.9–25.5

Precipitation112 mm/mo 58.8–248

Air humidity60.9 % 60.4–65.9

Vapour deficit1,299 Pa 962–1,331

Cloud cover16.8 % 15.2–22.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)