Alticola stoliczkanus

(Blanford, 1875) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Cricetidae/Alticola

At a glance

Occurrence records109

Data sources8

Biological traits11

DNA specimens10

eDNA detections12

Sources8 archives

Databases and archives Alticola stoliczkanus's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility109 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF109 records

Environmental DNA1 datasets · 0 countries12 detections

DNA & barcodingBOLD10 specimens

01Narrative

Stolička's or Stoliczka's mountain vole (Alticola stoliczkanus) is a species of rodent in the family Cricetidae. It is found in China, Pakistan, India and Nepal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAmnioteDBEltonTraits

Size & morphology3

Body mass30.14 g

⚠ sources differ — PanTHERIA: 30.14 g · AmnioteDB: 30.14 g · EltonTraits: 27.47 g

Head body length108 mm

SVL10.84 cm

Life cycle & reproduction1

Litter size7.77

Diet & foraging1

Plant other100 %

Habitat & environment2

Habitat breadth1

Terrestriality1.00

Physiology & chemistry2

Precipitation mean59.33 mm

Temperature mean-37.98 decidegC

Other traits2

Activity cycle1.00

Foraging stratumG

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alticola stoliczkanus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

24Cmostly conserved

25Cmostly conserved

42Tmostly conserved

69Tmostly conserved

81Tmostly conserved

102Cmostly conserved

108Cmostly conserved

114Gmostly conserved

126Gmostly conserved

129Cmostly conserved

132Gmostly conserved

138Avariable

141Gmostly conserved

147Cmostly conserved

150Gmostly conserved

156Tmostly conserved

159Cmostly conserved

168Amostly conserved

180Tmostly conserved

201Tvariable

213Cmostly conserved

216Tmostly conserved

219Amostly conserved

234Gmostly conserved

237Tmostly conserved

243Amostly conserved

249Cmostly conserved

252Avariable

264Gmostly conserved

276Gmostly conserved

279Tmostly conserved

306Tmostly conserved

324Cmostly conserved

325Cmostly conserved

336Gmostly conserved

339Avariable

354Gmostly conserved

369Gvariable

372Tmostly conserved

382Amostly conserved

384Cmostly conserved

402Tmostly conserved

405Tmostly conserved

408Cmostly conserved

414Cmostly conserved

417Cmostly conserved

423Cmostly conserved

429Cmostly conserved

432Gmostly conserved

438Amostly conserved

468Gmostly conserved

483Tmostly conserved

489Cmostly conserved

498Amostly conserved

510Tmostly conserved

522Gmostly conserved

549Tmostly conserved

552Cmostly conserved

555Tmostly conserved

564Tmostly conserved

567Tmostly conserved

573Cmostly conserved

576Tmostly conserved

579Tmostly conserved

582Cmostly conserved

585Avariable

615Amostly conserved

633Tmostly conserved

ATAGTAGGGACAGCCCTTAGCATCCTAATTCGAGCAGAACTTGGACAACCAGGCGCTCTATTAGGCGATGACCAAATTTATAATGTAGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes6

BINs2

Most divergent pair9.8%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alticola barakshinsame genus9.5%Alticola lemminussame genus11.1%Alticola strelzowisame genus11.4%Alticola semicanussame genus11.5%Myodes centralissame family11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type109 records

Wild obs. + sensor9

Museum / vouchered100

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 4≤1 km 3≤10 km 2

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 5≤10 km 4

9 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	46
Washington, US	37
Wuzhou, CN	5
South Kensington, GB	4
Berkeley, US	4
Toronto, CA	3

6 institutions · 99 of 100 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Alticola stoliczkanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)