Alternaria radicina

Meier, Drechsler & E.D.Eddy · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Alternaria

At a glance

Occurrence records34

Data sources11

Biological traits0

DNA specimens30

eDNA detections33

Sources11 archives

Databases and archives Alternaria radicina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF34 records

Environmental DNA4 datasets · 2 countries33 detections

DNA & barcodingBOLD · NCBI30 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Alternaria radicina is a fungal plant pathogen infecting carrots.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition30 compounds

Compounds documented for Alternaria radicina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols5

Cycloartane triterpenoids4

2-pyrone derivatives4

Cycloabietane diterpenoids3

Macrolide lactones2

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,5S,7R,8S,17S)-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadeca-10,13-diene-12,15-dione	present	NPASS
(1S,2R,5R,7S,8R,11S,17R)-11-hydroxy-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadec-13-ene-12,15-dione	present	NPASS
(1S,2R,5R,7S,8R,12R,15S,16R,17R)-17-hydroxy-2,7,15-trimethyl-13-oxapentacyclo[9.7.0.02,8.05,7.012,16]octadec-10-en-14-one	present	NPASS
(1S,2R,5R,7S,8R,13R,14R,17R)-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadec-10-ene-12,15-dione	present	NPASS
(24R)-9,19-cycloart-25-ene-3beta,24-diol	present	NPASS
(2R)-2-hydroxy-2,4-dimethyl-5-[(E)-prop-1-enyl]furan-3-one	present	LOTUS
(2R,3R)-3-hydroxy-2-methyl-7-[(E)-prop-1-enyl]-2,3-dihydropyrano[3,2-c]pyran-4,5-dione	present	LOTUS
(2S,3S)-3-hydroxy-2-methyl-7-[(Z)-prop-1-enyl]-2,3-dihydropyrano[3,2-c]pyran-4,5-dione	present	LOTUS
(2S,5S,7R,8S,10R,17S)-10-hydroxy-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadeca-1(11),13-diene-12,15-dione	present	NPASS
(2S,5S,7R,8S,17S)-2,7,14-trimethyl-16-oxapentacyclo[9.7.0.02,8.05,7.013,17]octadeca-1(11),13-diene-12,15-dione	present	NPASS

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternaria radicina has left across the world's sequence archives.

At a glance

DNA specimens30

Marker genes2

GenBank sequences10

eDNA detections33

Countries3

The DNA barcodea real sequence read deposited for this species

ITSON127411.1 ↗417 bp

ACGT

AGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACACAATATGAAGGCGGGCTGGAATCTTTCGGGGTTACAGCCTTGC …

Alternaria radicina isolate Ac77 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alternaria radicina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈34 644 183 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Alternaria radicina0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type34 records

Wild obs. + sensor7

Museum / vouchered23

Cultivated / captive4

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 3 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 2≤10 km 2>10 km 3

7 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence23

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	7
Auckland, NZ	2
Catholic University of Pekinglocation not on record	2
Madison, US	2
Vancouver, CA	1
Pullman, US	1
Olocation not on record	1
ILLSlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

9 institutions · 18 of 23 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA33 detections

Where the DNA of Alternaria radicina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys4

Countries2

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.3 °C 13.4–21.1

Seasonal swing summer↔winter27.4 °C

Max temp (day)23.0 °C 19.3–26.7

Min temp (night)11.1 °C 8.80–13.3

Precipitation42.6 mm/mo 12.9–72.2

Air humidity48.6 % 41.6–55.6

Moisture balance-81.3 mm/mo -116–-46.9

Vapour deficit1,337 Pa 854–1,820

Wind speed4.10 m/s 2.80–5.50

Cloud cover29.2 % 23.1–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)