Alternaria mali

Roberts · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Alternaria

At a glance

Occurrence records31

Data sources11

Biological traits0

DNA specimens27

eDNA detections27

Sources11 archives

Databases and archives Alternaria mali's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS35 compounds

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD · NCBI27 specimens

01Narrative

Alternaria mali, also called alternaria blotch of apple, is a pathogenic fungus affecting plants. It is prevalent in the southern United States and elsewhere, and damages the leaves of infected apple trees.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition35 compounds

Compounds documented for Alternaria mali across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dibenzocyclooctadienes lignans10

Cycloartane triterpenoids3

Lanostane, Tirucallane and Euphane triterpenoids2

Isocoumarins2

Dibenzylbutane lignans1

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3S,9R,12S,13S,16R,17R)-8,8,13,17-tetramethyl-16-[(1S)-1-[(2R)-5-methyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-7-oxapentacyclo[10.7.0.01,3.03,9.013,17]nonadec-4-en-6-one	present	NPASS
(2S,3R,3aS,7aR)-2-(1,3-Benzodioxol-5-yl)-3,3a,7,7a-tetrahydro-3a,7a-dimethoxy-3-methyl-5-(2-propen-1-yl)-6(2H)-benzofuranone	present	NPASS
(Z,6R)-6-[(5S,10S,12S,13R,14S,17R)-12-hydroxy-4,4,10,13,14-pentamethyl-3-oxo-1,2,5,6,7,11,12,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl]-2-methylhept-2-enoic acid	present	NPASS
Altenuene	present	LOTUS
Alternarian Acid	present	LOTUS
Alternariol monomethyl ether	present	LOTUS
Angeloylgomisin H	present	NPASS
Angeloylgomisin P	present	NPASS
BQCSILLZKUEZCI-GAMOQPQDSA-N	present	NPASS
Changnanic acid	present	NPASS

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternaria mali has left across the world's sequence archives.

At a glance

DNA specimens27

Marker genes2

GenBank sequences10

eDNA detections27

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ762171.1 ↗435 bp

ACGT

AGGGATCATTGCTGGAACGCGCCCCAGGCGCACCCAGAAACCTTTGTGAACTTATACCTTACTCGGCGCTAGCTGGTCCTTCGGAGCCCC …

Alternaria mali isolate AM-11 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type31 records

Museum / vouchered31

Range

Area of Occupancy AOO68 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 8≤10 km 2>10 km 1

11 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence31

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	9
Guasave, MX	8
Hirosaki Universitylocation not on record	5
ILLSlocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	1

5 institutions · 25 of 31 vouchered records shown · 5 without an institution code

09Environmental DNA27 detections

Where the DNA of Alternaria mali was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 22.0–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C

Min temp (night)13.9 °C

Precipitation5.50 mm/mo

Air humidity39.8 %

Moisture balance-124 mm/mo

Vapour deficit1,940 Pa

Wind speed2.40 m/s

Cloud cover21.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)