Alternaria dauci

(J.G.Kühn) J.W.Groves & Skolko · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Alternaria

At a glance

Occurrence records67

Data sources10

Biological traits0

DNA specimens25

eDNA detections23

Sources10 archives

Databases and archives Alternaria dauci's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF67 records

Environmental DNA2 datasets · 3 countries23 detections

DNA & barcodingBOLD · NCBI25 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Alternaria dauci is a plant pathogen. The English name of the disease it incites is "carrot leaf blight".

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Alternaria dauci across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Isocoumarins1

Zearalenones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
2-(4,5-Dihydroxy-2-methylphenyl)-4-methoxybenzenecarboperoxoic acid	present	LOTUS
Aldaulactone	present	LOTUS
Alternariol	present	LOTUS
Dehydroaltenusin	present	LOTUS

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternaria dauci has left across the world's sequence archives.

At a glance

DNA specimens25

Marker genes3

GenBank sequences10

eDNA detections23

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPQ732499.1 ↗533 bp

ACGT

AGGGATCATTACACAAATATGAAGGCGGGCTGGCACCTCTCGGGGTGGCAGCCTTGCTGAATTATTCACCCGTGTCTTTTGCGTACTTCT …

Alternaria dauci isolate PC4-5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alternaria dauci carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈34 906 709 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Alternaria dauci0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

08Occurrence & distribution

Record type67 records

Wild obs. + sensor22

Museum / vouchered43

Cultivated / captive2

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 10>10 km 1

11 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence43

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	12
DPIlocation not on record	11
Bernard Price Institute for Palaeontological Researchlocation not on record	7
University of Tennessee at Chattanoogalocation not on record	2
ILLSlocation not on record	2
Görlitz, DE	1
Kensington, AU	1

7 institutions · 36 of 43 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA23 detections

Where the DNA of Alternaria dauci was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 11.4–20.1

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 15.2–25.8

Min temp (night)8.20 °C 7.40–12.8

Precipitation79.6 mm/mo 20.3–108

Air humidity57.3 % 43.3–64.1

Moisture balance-38.4 mm/mo -107–11.8

Vapour deficit733 Pa 521–1,699

Wind speed5.30 m/s 3.00–5.70

Cloud cover35.1 % 24.3–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)