Alternaria brassicae

(Berk.) Sacc. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Alternaria

At a glance

Occurrence records554

Data sources11

Biological traits0

DNA specimens84

eDNA detections210

Sources11 archives

Databases and archives Alternaria brassicae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility546 records↗

OBISOcean Biodiversity Information System8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI210 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics84 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS19 compounds

Occurrence & distributionGBIF · OBIS554 records

Environmental DNA9 datasets · 20 countries210 detections

DNA & barcodingBOLD · NCBI84 specimens

Genome at a glanceGoaT · NCBI≈34 Mbp

01Narrative

Alternaria brassicae est une espèce de champignons phytopathogènes de la famille des Pleosporaceae et du genre Alternaria. Il parasite en particulier les Crucifères. Les maladies qu'il provoque sont nommées Alternariose des crucifères, Alternariose du chou, Alternariose du navet, Maladie des taches noires, Taches grises du chou, Taches grises du navet, Taches noires du colza. Ce champignon est répandu dans le monde entier.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition19 compounds

Compounds documented for Alternaria brassicae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclic peptides $ Depsipeptides7

Drimane sesquiterpenoids4

Apocarotenoids(ε-)2

Purine alkaloids1

Chromones1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(2'S)-2-(2-acetoxypropyl)-7-hydroxy-5-methylchromone	present	LOTUS
(2R,3S)-4-methylidene-5-oxo-2-pentyloxolane-3-carboxylic acid	present	LOTUS
(3R,10R,13S,16S,19S)-16-[(2S)-butan-2-yl]-10,11,14-trimethyl-3-(2-methylpropyl)-13-propan-2-yl-4-oxa-1,8,11,14,17-pentazabicyclo[17.3.0]docosane-2,5,9,12,15,18-hexone	present	LOTUS
(3R,10R,13S,16S,19S)-3-isobutyl-13-isopropyl-10,11,14-trimethyl-16-[(1S)-1-methylpropyl]-4-oxa-1,8,11,14,17-pentazabicyclo[17.3.0]docosane-2,5,9,12,15,18-hexone	present	LOTUS
(4E)-5-[(1S)-1-hydroxy-2,6,6-trimethyl-4-oxocyclohex-2-en-1-yl]-3-methylpenta-2,4-dienoic acid	present	LOTUS
(E)-3-phenyl-1-[(2S,5S)-2,4,5-trimethylpiperazin-1-yl]prop-2-en-1-one	present	LOTUS
2-[7-(Hydroxymethyl)-6-propyl-1-benzofuran-2-yl]propan-2-ol	present	LOTUS
6-[[(E,2R)-5-hydroxy-4-methylpent-3-en-2-yl]amino]-3,7-dihydropurin-2-one	present	LOTUS
6-epi-Albrassitriol	present	LOTUS
Abscisic Acid	present	LOTUS

05DNA & barcoding84 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternaria brassicae has left across the world's sequence archives.

At a glance

DNA specimens84

Marker genes3

GenBank sequences10

eDNA detections210

Countries20

The DNA barcodea real sequence read deposited for this species

ITSPZ134490.1 ↗221 bpAustralia · 2024

ACGT

GGGAGGAAAATNTGAAGGCGGGCTGGAACTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCT …

Alternaria brassicae isolate EG8 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alternaria brassicae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 821 513 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Alternaria brassicae0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

08Occurrence & distribution

Record type554 records

Wild obs. + sensor30

Museum / vouchered500

Cultivated / captive4

Other20

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 12≤10 km 17

29 georeferenced · 1 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 3≤1 km 15≤10 km 141>10 km 43

202 georeferenced · 298 without coordinates

Open the institutions mapphysical evidence500

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	92
DPIlocation not on record	67
Catholic University of Pekinglocation not on record	30
ILLSlocation not on record	26
Auckland, NZ	26
Madison, US	16
Tartu, EE	8
Institute of Botany of the Academy of Science of the Republic of Uzbekistanlocation not on record	4
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	4
Chicago, US	4
Bronx, US	3
Champaign, US	3
Pullman, US	3
Chapel Hill, US	3
Lincoln, US	3
Kuopio, FI	3
National Institute of Biological Resourceslocation not on record	3
Gujarat Biodiversity Gene Banklocation not on record	3
PHlocation not on record	3
Brown Universitylocation not on record	2
TENN-Flocation not on record	2
WU-MYClocation not on record	2
FLASlocation not on record	2
Helsinki, FI	2
Uniwersytet Łódzkilocation not on record	2
Olocation not on record	2
Université de Montréal Biodiversity Centrelocation not on record	2
Kew, GB	2
Museo Entomologico de Leonlocation not on record	1
Clemson, US	1
Stockholm, SE	1
Kensington, AU	1
McWane Science Centerlocation not on record	1
Baton Rouge, US	1
University of Tennessee at Chattanoogalocation not on record	1
Nurata nature reservelocation not on record	1
LDlocation not on record	1
CABI Bioscience Genetic Resource Collectionlocation not on record	1
Hirosaki Universitylocation not on record	1
St. Paul, US	1

40 institutions · 334 of 500 vouchered records shown · 144 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA210 detections

Where the DNA of Alternaria brassicae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found210

Studies independent surveys9

Countries20

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 210 detections have coordinates

Open the map20 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature25.4 °C

pH7.25 5.10–8.70

Conductivity115 µS/cm 19.0–4,900

Organic carbon1.28 % 0.13–5.51

Water content3.90 % 0.508–21.6

Nitrate-N10.0 mg/kg 1.00–150

Phosphorus20.0 mg/kg 2.00–290

Clay14.8 % 7.59–64.9

Sand77.3 % 24.9–92.2

Depth0 m 0–0.2

SoilSedimentSodosolRudosolTenosolsTenosolCalcarosolVertosols

25 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 10.9–21.5

Seasonal swing summer↔winter14.3 °C

Max temp (day)20.8 °C 14.2–26.7

Min temp (night)12.8 °C 6.90–16.3

Precipitation56.0 mm/mo 21.0–177

Air humidity58.6 % 48.9–64.1

Moisture balance-56.5 mm/mo -142–44.7

Vapour deficit766 Pa 482–1,166

Wind speed3.50 m/s 2.40–5.30

Cloud cover32.1 % 11.9–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 145 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)