Alternaria alternata

(Fr.) Keissl. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Alternaria

At a glance

Occurrence records3 122

Data sources13

Biological traits0

DNA specimens1 550

eDNA detections1 987

Sources13 archives

Databases and archives Alternaria alternata's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 554 records↗

OBISOcean Biodiversity Information System568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 987 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 550 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS191 compounds

Occurrence & distributionGBIF · OBIS3 122 records

Environmental DNA6 datasets · 23 countries1 987 detections

DNA & barcodingBOLD · NCBI1 550 specimens

Genome at a glanceGoaT · NCBI33 Mbp

01Narrative

Alternaria alternata is a fungus which has been recorded causing leaf spot and other diseases on over 380 host species of plant. It is an opportunistic pathogen on numerous hosts causing leaf spots, rots and blights on many plant parts. It can also cause upper respiratory tract infections and asthma in humans with compromised immunity.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition191 compounds

Compounds documented for Alternaria alternata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Prenyl quinone meroterpenoids70

Isocoumarins21

Bisnaphthalenes17

Open-chain polyketides11

Naphthalenes and derivatives8

Documented compounds191 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-(10R)-7-hydroxy-3-(2-hydroxypropyl)-5,6-dimethylisochromen-1-one	present	LOTUS
(+)-(2S,3S,4aS)-altenuene-2-acetoxy ester	present	LOTUS
(+)-(2S,3S,4aS)-altenuene-3-acetoxy ester	present	LOTUS
(+)-alternaone A	present	LOTUS
(+)-alternaone B	present	LOTUS
(-)-(2R,3R,4aR)-altenuene-2-acetoxy ester	present	LOTUS
(-)-(2R,3R,4aR)-altenuene-3-acetoxy ester	present	LOTUS
(-)-alternaone A	present	LOTUS
(-)-alternaone B	present	LOTUS
(-)-Alternatiol	present	LOTUS

05DNA & barcoding1 550 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternaria alternata has left across the world's sequence archives.

At a glance

DNA specimens1 550

Marker genes6

GenBank sequences10

eDNA detections1 987

Countries59

The DNA barcodea real sequence read deposited for this species

ITSPV362247.1 ↗517 bpChina · 2024

ACGT

TCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC …

Alternaria alternata isolate D58 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8SEF1-alpha

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alternaria alternata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size32 990 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Alternaria alternata0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 101×GoaT · Wioletta Wieloch 2006

GoaT · Wioletta Wieloch 2006 — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness99.1% BUSCO

08Occurrence & distribution

Record type3 122 records

Wild obs. + sensor296

Museum / vouchered2 773

Cultivated / captive35

Other18

Range

Area of Occupancy AOO3 316 km²

Depth

0–200 m sunlit548

200–1000 m twilight3

1–4 km midnight0

>4 km abyssal0

median 10 m · max 340 m · 551 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 26≤1 km 14≤10 km 236>10 km 3

279 georeferenced · 17 without coordinates

Open the mapobservation + sensor296

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 44≤1 km 18≤10 km 62>10 km 17

141 georeferenced · 2 632 without coordinates

Open the institutions mapphysical evidence2 773

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 33 without coordinates

Open the mapnot free-living35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	173
Auckland, NZ	92
Guasave, MX	22
ILLSlocation not on record	19
National Institute of Biological Resourceslocation not on record	13
Bronx, US	12
Academy of Sciences of the Republic of Uzbekistanlocation not on record	12
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	11
Pullman, US	9
Durango, MX	9
Museo Entomologico de Leonlocation not on record	8
TNMlocation not on record	6
Laboratorio de Ictiologialocation not on record	6
Bernard Price Institute for Palaeontological Researchlocation not on record	6
Uppsala, SE	5
WU-MYClocation not on record	4
The University of Hong Konglocation not on record	4
BDBClocation not on record	4
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	4
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	3
Helsinki, FI	3
San Sebastián, ES	3
CA	3
Hobart, AU	3
Institut Pasteur, Parislocation not on record	3
MeiseBGlocation not on record	3
Karlsruhe, DE	2
Université de Montréal Biodiversity Centrelocation not on record	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
SLU Artdatabankenlocation not on record	2
Slovenian Forestry Institutelocation not on record	1
Kensington, AU	1
Görlitz, DE	1
Philadelphia, US	1
Helsinki, FI	1
Tartu, EE	1
Kew, GB	1
Nurata nature reservelocation not on record	1
UAclocation not on record	1
Sydney Medical Schoollocation not on record	1

40 institutions · 458 of 2 773 vouchered records shown · 1 630 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 987 detections

Where the DNA of Alternaria alternata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 987

Studies independent surveys6

Countries23

Verifiable raw sequence linked540

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 987 detections have coordinates

Open the map23 countries0

Birch(Hardwood) dowel buried in soil of a co…Pine(Softwood) dowel buried in soil of a con…Afrotropictomato sauceSpruce(Softwood) dowel buried in soil of a c…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 7.70–19.1

Seasonal swing summer↔winter9.40 °C

Max temp (day)14.2 °C 9.10–25.1

Min temp (night)11.4 °C 6.10–14.8

Precipitation80.2 mm/mo 51.8–143

Air humidity64.3 % 53.1–65.2

Vapour deficit513 Pa 368–1,023

Cloud cover57.1 % 26.3–68.9

CHELSA 1981–2010, ~9 km grid, at location & month of 675 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alternaria alternata

At a glance

Sources13 archives

Compound class profile5 classes

Documented compounds191 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 122 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 122 records