Alternanthera sessilis
(L.) R.Br. ex DC. · speciesAt a glance
Occurrence records6 713
Data sources15
Biological traits56
DNA specimens43
eDNA detections22
Sources15 archives
Databases and archives Alternanthera sessilis's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 713 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics43 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources56 traits
Chemical compositionLOTUS · NPASS11 compounds
Occurrence & distributionGBIF6 713 records
Environmental DNA1 datasets · 5 countries22 detections
DNA & barcodingBOLD · NCBI43 specimens
Genome at a glanceCCDB · GIFT2n = 34
01Narrative
Alternanthera nodiflora (common name common joyweed) is a species of flowering plant in the family Amaranthaceae. It is endemic to Australia, growing in all mainland states It is naturalised in Tasmania, over much of Africa, in Japan, and in Myanmar.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology21
Fruit length1 mm
⚠ sources differ — AusTraits: 1 mm · GIFT: 1.62 mm
Fruit length max2.5 mm
Fruit length min2 mm
Fruit width1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 2 mm
Inflorescence length max0.15 cm
Inflorescence length min0.07 cm
Leaf length20 mm
Leaf length max115 mm
Leaf length min15 mm
Leaf width5 mm
Leaf width max18 mm
Leaf width min3 mm
Plant height0.4 m
⚠ sources differ — GIFT: 0.4 m · AusTraits: 0.8 m · TRY: 0.325 m
Plant height max1 m
Plant height min0.05 m
Seed length1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.282 mg
⚠ sources differ — TRY: 0.282 mg · AusTraits: 0.3 mg · GIFT: 0.332 mg
Seed mass max0.48 mg
Seed mass min0.165 mg
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — AusTraits: zoochory · GIFT: unspecialized
Flowering endAug
Flowering startJul
Flowering timeyyyyyyyyyyyy
Life formsubshrub or helophyte
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual · GIFT: perennial
Lifespan years1 years
Pollination syndromeinsect+wind
Raunkiær life formtherophyte
Reproduction asexualpresent
Resprouting capacityfire_killed
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 750 m
Elevation min7.5 m
Epiphyteterrestrial
Fruit typeutricle
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria
Leaf compoundnesssimple
Leaf shapelanceolate linear
Succulenceno
Woodinessnon-woody
Physiology & chemistry5
Leaf n20 mg/g
Leaf p2 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Specific leaf area (SLA)21.1 mm²/mg
Other traits1
Shoot orientationascending
03Chemical composition11 compounds
Compounds documented for Alternanthera sessilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Oleanane triterpenoids6
Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids1
Pyridine alkaloids1
Aminoacids1
Flavones1
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-11-hydroxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1R,4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-3-[(2S,3R,4S,5S)-4,5-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-11-hydroxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1R,4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-3-[(2S,3R,4S,5S)-4,5-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-11-hydroxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1R,4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-11-hydroxy-10-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-3-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1R,4aS,6aS,6aS,6bR,8aR,10S,11R,12aR,14bS)-11-hydroxy-10-[(2R,3R,4R,5R,6S)-5-hydroxy-6-(hydroxymethyl)-4-[(2R,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxy-3-[(2S,3S,4R,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1S,4aR,6aS,6aS,6bR,8aR,10R,11S,12aS,14bR)-10-[(2R,3R,4S,5S,6S)-3-[(2R,3R,4R,5R)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2R,3R,4R,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-11-hydroxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1S,4aS,6aS,6aR,6bR,8aS,10R,11R,12aS,14bS)-10-[(2R,3R,4S,5R,6R)-3-[(2S,3S,4S,5S)-4,5-dihydroxy-3-[(2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3S,4R,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-11-hydroxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| Betaine | present | LOTUS | |
| Chrysin | present | NPASS | |
| SOKRNBGSNZXYIO-KEXRUCRJSA-N | present | NPASS |
05DNA & barcoding43 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternanthera sessilis has left across the world's sequence archives.
At a glance
DNA specimens43
Marker genes7
GenBank sequences10
eDNA detections22
Countries7
The DNA barcodea real sequence read deposited for this species
TGGCATAACAACAAACCCCGGCGTGCTATGCGCCAAGGAACATGAACCATAGTCTGCCAGCCCTCGGCCCGGGTCCTCGGTGCGGGGGTG …
Alternanthera sessilis cultivar Lowland sessile joyweed Ecotype 2 voucher DMB84 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★trnL-F★ITS2★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Alternanthera sessilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidy2× diploid · measured
Chromosome records28–962n range34median34mode8records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 343×CCDB · book-ipcn65 · CCDB · book-ipcn66 · GIFT · GIFT (floras)
CCDB · book-ipcn65 — Sharma & B. 1965
CCDB · book-ipcn66 — Sharma & Banik 1965
GIFT · GIFT (floras)
2n 281×CCDB · new-zealand40
CCDB · new-zealand40
2n 321×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
2n 361×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 401×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 961×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 173×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Koul, A. K., A. K. Wakhlu & J. L. KARIHALOO. 1976a. Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33.
CCDB · book-ipcn73-74 — BEHERA B., & S.N. PATNAIK. 1974. Cytotaxonomic studies ill the family Amaranthaceae. Cytologia 39: 121-131.
n 181×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — MITRA, K., & N. DATTA. 1967. In IOPB chromosome number reports XIII. Taxon 16: 445-461.
n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type6 713 records
Wild obs. + sensor2 963
Museum / vouchered3 576
Cultivated / captive1
Other173
Origin
Native73
Introduced94
Range
Area of Occupancy AOO15 096 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 1 178≤1 km 227≤10 km 165>10 km 74
1 644 georeferenced · 1 319 without coordinates
Open the mapobservation + sensor2 963
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 83≤1 km 99≤10 km 136>10 km 68
386 georeferenced · 3 190 without coordinates
Open the institutions mapphysical evidence3 576
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions131 of 293 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 199 |
| Beijing, CN | 173 |
| Taipei, TW | 171 |
| Taipei, TW | 112 |
| Pretoria, ZA | 110 |
| Guangzhou, CN | 101 |
| Nanjing, CN | 70 |
| Guilin, CN | 68 |
| Kunming, CN | 67 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 67 |
| Kochi, JP | 62 |
| Kew, GB | 60 |
| Tokushima, JP | 57 |
| MeiseBGlocation not on record | 51 |
| Kathmandu, NP | 49 |
| Canberra, AU | 46 |
| Adam Mickiewicz University in Poznańlocation not on record | 46 |
| Museo Entomologico de Leonlocation not on record | 45 |
| HNBlocation not on record | 41 |
| TAIElocation not on record | 41 |
| QAUlocation not on record | 35 |
| University of Papua New Guinealocation not on record | 32 |
| Durban, ZA | 32 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 32 |
| Xiamen, CN | 32 |
| Bronx, US | 29 |
| Yaoundé, CM | 29 |
| University of Stellenboschlocation not on record | 28 |
| Yangling, CN | 26 |
| Brisbane, AU | 26 |
| WAGlocation not on record | 26 |
| Odawara, JP | 24 |
| Guangzhou, CN | 24 |
| Chengdu, CN | 24 |
| Plocation not on record | 23 |
| Tampa, US | 23 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 22 |
| Nishihara, JP | 21 |
| Frankfurt am Main | 21 |
| Leiden University Medical Centerlocation not on record | 19 |
| Siouxland Heritage Museumlocation not on record | 18 |
| Taipei, TW | 18 |
| Durham, US | 17 |
| Université de Strasbourglocation not on record | 17 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 16 |
| Wuhan, CN | 16 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 16 |
| Hangzhou, CN | 16 |
| Université du Lomélocation not on record | 15 |
| Paris, FR | 15 |
| LDlocation not on record | 15 |
| Tsukuba, JP | 15 |
| Miami, US | 14 |
| Baroda, IN | 14 |
| Universidad Nacional de Colombia (UNAL)location not on record | 14 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 14 |
| Jena Microbial Resource Collectionlocation not on record | 13 |
| LBVlocation not on record | 13 |
| National Biodiversity Institute, Costa Ricalocation not on record | 13 |
| Durango, MX | 13 |
| Yunnan Universitylocation not on record | 13 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 13 |
| Chiba, JP | 12 |
| Berlin, DE | 12 |
| Moscow State Universitylocation not on record | 11 |
| Honolulu, US | 11 |
| Palmerston, AU | 11 |
| Changsha, CN | 11 |
| Chicago, US | 10 |
| Mexico City, MX | 10 |
| Nanjing, CN | 10 |
| Columbia, US | 10 |
| Pondicherry, IN | 10 |
| Puerto Ayora, EC | 9 |
| INBIOlocation not on record | 9 |
| Awka, NG | 8 |
| Smithfield, AU | 8 |
| Guiyang, CN | 8 |
| Universidad del Quindío (UniQuindío)location not on record | 8 |
| BMlocation not on record | 7 |
| Herbier National du Gabonlocation not on record | 7 |
| Shanghai, CN | 7 |
| Dehra Dun, IN | 7 |
| Montréal, CA | 7 |
| IFAN Ch. A. Dioplocation not on record | 7 |
| LSF/FSA/UAClocation not on record | 6 |
| Edinburgh, GB | 6 |
| Jackson, US | 6 |
| Fayetteville, US | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Central China Normal Universitylocation not on record | 6 |
| Antiguo Cuscatlán, SV | 6 |
| Instituto de Investigação Científica Tropicallocation not on record | 6 |
| Universidad de Nariño (UdeNar)location not on record | 6 |
| Universidad de Antioquia (UdeA)location not on record | 6 |
| National Museums of Kenyalocation not on record | 5 |
| Bloomington, US | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Nagano City, JP | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| MAlocation not on record | 5 |
| Sendai, JP | 5 |
| Zhejiang Museum of Natural Historylocation not on record | 5 |
| Seoul, KR | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| BISHlocation not on record | 5 |
| BRLUlocation not on record | 5 |
| CASlocation not on record | 5 |
| South Kensington, GB | 5 |
| FJIDClocation not on record | 5 |
| EL PASO, US | 5 |
| Brussels, BE | 4 |
| Bando, JP | 4 |
| Calabar, NG | 4 |
| Nagasaki University - Fisherieslocation not on record | 4 |
| Tuscaloosa, US | 4 |
| South China Normal Universitylocation not on record | 4 |
| Anhui Normal Universitylocation not on record | 4 |
| Guatemala City, GT | 4 |
| Université National du Béninlocation not on record | 4 |
| UFMSlocation not on record | 4 |
| Anton de Kom University of Surinamelocation not on record | 4 |
| Stockholm, SE | 4 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 4 |
| Blumenau, BR | 4 |
| Loja, EC | 4 |
| Uppsala, SE | 4 |
| Chengdu, CN | 4 |
| UERJlocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Glocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 3 |
| Sanda, JP | 3 |
| Seychelles National Herbariumlocation not on record | 3 |
| Elocation not on record | 3 |
| Fujian Institute of Subtropical Botanylocation not on record | 3 |
| Xian, CN | 3 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Campo Grande, BR | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Universidad Nacional Agrarialocation not on record | 3 |
| Christchurch, NZ | 3 |
| Forestry Research Institute of Nigerialocation not on record | 3 |
| Sangmiung Universitylocation not on record | 3 |
| Cambridge, US | 3 |
| CNF-UFHBlocation not on record | 3 |
| Aarhus, DK | 3 |
| Clocation not on record | 3 |
| Cuiabá, BR | 3 |
| Porto Alegre, BR | 3 |
| Otaru, JP | 2 |
| Mlocation not on record | 2 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 2 |
| Haramaya Universitylocation not on record | 2 |
| Barcelona, ES | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Addis Ababa, ET | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| IPHAMETRAlocation not on record | 2 |
| IAPlocation not on record | 2 |
| Nishihara, JP | 2 |
| UFRRJlocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| WNNUlocation not on record | 2 |
| IFANlocation not on record | 2 |
| MEXUlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Cibinong, ID | 2 |
| Salvador, BR | 2 |
| Zhengzhou, CN | 2 |
| Université de Bordeauxlocation not on record | 2 |
| LISClocation not on record | 2 |
| LNBG$location not on record | 2 |
| Station d'Ecologie de Lamtolocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| Mississippi State, US | 2 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 2 |
| Monastir, TN | 2 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 2 |
| Beijing, CN | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| UEMAlocation not on record | 2 |
| Burlington, US | 2 |
| FLASlocation not on record | 2 |
| UNESP-IBILCElocation not on record | 2 |
| Gump Stationlocation not on record | 2 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 2 |
| Rishon Le Zion, IL | 2 |
| EFGlocation not on record | 1 |
| Riverside, US | 1 |
| Wuhan, CN | 1 |
| University of Hamburglocation not on record | 1 |
| Universidade do Estado de Mato Grossolocation not on record | 1 |
| Podgorica, ME | 1 |
| 武陵山动植物研究所location not on record | 1 |
| Xinxiang, CN | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| National Range Agencylocation not on record | 1 |
| HUAlocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Fort Worth, US | 1 |
| AUAlocation not on record | 1 |
| Mérida, MX | 1 |
| Ojo, NG | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 1 |
| San José, CR | 1 |
| University of Calabar/Department of Plant and Ecological Studies Herbariumlocation not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Minia, EG | 1 |
| Little Rock, US | 1 |
| Santarém, BR | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| ex-Centro Nacional de Investigação Cientifica (CNIC)location not on record | 1 |
| HACAMlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Austin, US | 1 |
| Llocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Mount Annan, AU | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Hobart, AU | 1 |
| Botanic Gardenlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| National Natural History Collectionslocation not on record | 1 |
| EAlocation not on record | 1 |
| Olocation not on record | 1 |
| EMTCMlocation not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Goucher Collegelocation not on record | 1 |
| Cincinnati, US | 1 |
| Managua, NI | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| USP-IBlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Toyama, JP | 1 |
| Dover, US | 1 |
| Provo, US | 1 |
| Salamanca, ES | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| US | 1 |
| Feira de Santana, BR | 1 |
| Claremont, US | 1 |
| Philadelphia, US | 1 |
| Tomioka, JP | 1 |
| Adelaide, AU | 1 |
| Chadron, US | 1 |
| UnBlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| UFSJlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| CEPLAClocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| BRNUlocation not on record | 1 |
| Cape Town, ZA | 1 |
| GAlocation not on record | 1 |
| KURAlocation not on record | 1 |
| St. Augustine, TT | 1 |
| Knoxville, US | 1 |
| CMULlocation not on record | 1 |
| Phoenix, US | 1 |
| Brookings, US | 1 |
| Lincoln, US | 1 |
| Montpellier, FR | 1 |
| Kagoshima, JP | 1 |
| Dresden, DE | 1 |
| Shanghai, CN | 1 |
293 institutions · 3 171 of 3 576 vouchered records shown · 403 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Alternanthera sessilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map5 countries0
Near river edge;Red soil
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median28.2 °C 8.10–28.2
Seasonal swing summer↔winter19.8 °C
Max temp (day)32.4 °C 11.9–33.9
Min temp (night)20.7 °C 4.20–21.7
Precipitation27.6 mm/mo 27.6–137
Air humidity52.6 % 42.2–57.5
Moisture balance-76.9 mm/mo -170–69.5
Vapour deficit1,689 Pa 460–2,235
Wind speed3.70 m/s 1.90–3.90
Cloud cover37.4 % 13.5–48.6
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.