Alternanthera philoxeroides
(Mart.) Griseb. · speciesAt a glance
Occurrence records38 659
Data sources13
Biological traits117
DNA specimens28
eDNA detections120
Sources13 archives
Databases and archives Alternanthera philoxeroides's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility38 659 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI120 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources117 traits
Chemical compositionLOTUS · NPASS15 compounds
Occurrence & distributionGBIF38 659 records
Environmental DNA2 datasets · 4 countries120 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB2n = 100
01Narrative
Alternanthera philoxeroides, commonly referred to as alligator weed, is a native species to the temperate regions of South America, which includes Argentina, Brazil, Paraguay and Uruguay. Argentina alone hosts around 27 species that fall within the range of the genus Alternanthera. Its geographic range once covered only the Parana River region of South America, but it has since expanded, having been introduced to over 30 countries, such as the United States, Japan, China, Australia, New Zealand and many more. This invasive species is believed to have been accidentally introduced to these non-native regions through sediments trapped by, or attached to, tanks and cargo of ships travelling from South America to these various areas.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology18
Leaf length20 mm
Leaf length max80 mm
Leaf length min20 mm
Leaf size536 mm²
Leaf width15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 23 mm
Leaf width max20 mm
Leaf width min10 mm
Plant height0.33 m
⚠ sources differ — GIFT: 0.33 m · AusTraits: 0.5 m · USDA: 0.061 m · TRY: 0.528 m
Plant height max0.5 m
Seed length0 mm
Seed length max0 mm
Seed length min0 mm
Seed mass0 mg
Seed mass max0 mg
Seed mass min0 mg
Seed width0 mm
Seed width max0 mm
Seed width min0 mm
Life cycle & reproduction29
After harvest regrowth rateSlow
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeunspecialized
Flower colourwhite
Flower conspicuousNo
Flowering timeynnnnnnnnnnn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formsubshrub or helophyte
Life spanperennial
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Reproduction asexualpresent
Resprout abilityNo
Seed spread rateNone
Sex typehermaphrodite
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticaquatic
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max500 m
Elevation mean325 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Growth formherb
Growth form USDAStoloniferous
Habitat GIFTÁrea Antrópica, Vegetação Aquática
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapenarrowly_elliptical obovate
Low growing grassNo
Root depth min10 in
Shape and orientationProstrate
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantYes
Fire toleranceNone
Frost free days min200 days
Leaf dry-matter content (LDMC)136 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min40 in
Salinity toleranceLow
Shade toleranceMedium
Soil pH max8.8 pH
Soil pH min4.8 pH
Specific leaf area (SLA)29.07 mm²/mg
Temperature min-3 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits5
Fall conspicuousNo
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max4 800 per acre
Planting density min1 700 per acre
03Chemical composition15 compounds
Compounds documented for Alternanthera philoxeroides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Amarylidaceae alkaloids $ Isoquinoline alkaloids4
Flavones2
Amarylidaceae alkaloids $ Iridoids monoterpenoids $ Isoquinoline alkaloids1
Amarylidaceae alkaloids1
Isoquinoline alkaloids1
Documented compounds15 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,13R,15R)-15-methoxy-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraene | present | NPASS | |
| (3alpha,11S)-1,2-Didehydro-3,7-dimethoxycrinan-11-ol | present | NPASS | |
| 6-[(2R,4S,5R,6R)-4,5-dihydroxy-6-methyloxan-2-yl]-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)chromen-4-one | present | LOTUS | |
| 6-[(2S,4R,5S,6S)-4,5-dihydroxy-6-methyloxan-2-yl]-5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)chromen-4-one | present | LOTUS | |
| 7H-(1,3)Dioxolo(4,5-j)pyrrolo(3,2,1-de)phenanthridin-7-one | present | NPASS | |
| [(1R,13R,15R,18S)-9,15-dimethoxy-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraen-18-yl] acetate | present | NPASS | |
| Betaine | present | LOTUS | |
| Buphanidrine | present | NPASS | |
| CFQIOFUUQUYVPY-UHFFFAOYSA-N | present | NPASS | |
| Crinine | present | NPASS |
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternanthera philoxeroides has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes6
GenBank sequences10
eDNA detections120
Countries4
The DNA barcodea real sequence read deposited for this species
CAACAAACCCCGGCGTGCTATGCGCCAAGGAACATGAACCACAGTCTGCCCGCCCTTGGCCCGGGTCCCCGGTGCGAGGGCGAGGCGGCA …
Alternanthera philoxeroides voucher APLW internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL7★rbcLa★ITS2★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Alternanthera philoxeroides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 100 n = 50
Ploidypolyploid inferred
Chromosome records28–1002n range100median100mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1003×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora
CCDB · ipcn-api-dl — Xu, B. s., R. f. Weng & M. z. Zhang. 1992. Chromosome numbers of Shanghai plants I. Invest. Stud. Nat. 12: 48–65.
CCDB · book-ipcn67-71 — DATTA, N., & u. CHATTERJEE. 1969. Cytological studies in three species of Alternanthera. Bull. Bot. Soc. Bengal 23 (1) 27-29.
CCDB · eflora
2n 281×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — HSU, C.-c. 1967. Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania No. 13: 117-130.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type38 659 records
Wild obs. + sensor17 588
Museum / vouchered2 150
Cultivated / captive13
Other18 908
Origin
Native236
Introduced1 372
Range
Area of Occupancy AOO30 856 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 6 579≤1 km 758≤10 km 534>10 km 199
8 070 georeferenced · 9 518 without coordinates
Open the mapobservation + sensor17 588
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 112≤1 km 160≤10 km 184>10 km 57
513 georeferenced · 1 637 without coordinates
Open the institutions mapphysical evidence2 150
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 13 records without
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions133 of 257 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Mount Annan, AU | 80 |
| Bronx, US | 55 |
| Taipei, TW | 54 |
| Auckland, NZ | 54 |
| Beijing, CN | 51 |
| Tampa, US | 50 |
| Canberra, AU | 49 |
| Blumenau, BR | 40 |
| Porto Alegre, BR | 39 |
| Jena Microbial Resource Collectionlocation not on record | 37 |
| Brisbane, AU | 35 |
| Christchurch, NZ | 35 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 33 |
| Bangkok, TH | 32 |
| Taipei, TW | 30 |
| Chengdu, CN | 30 |
| Austin, US | 29 |
| Jackson, US | 28 |
| Chapel Hill, US | 28 |
| Saint Louis, US | 27 |
| Tuscaloosa, US | 26 |
| US | 26 |
| San Isidro, AR | 24 |
| Kathmandu, NP | 22 |
| Museo Entomologico de Leonlocation not on record | 22 |
| Canadian Department of Agriculturelocation not on record | 22 |
| BIO-UNIPIlocation not on record | 22 |
| PUC-RSlocation not on record | 21 |
| Knoxville, US | 20 |
| Columbia, US | 19 |
| Miami, US | 19 |
| Córdoba, AR | 19 |
| Chiba, JP | 19 |
| Siouxland Heritage Museumlocation not on record | 18 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 18 |
| Federal University of Espírito Santolocation not on record | 17 |
| Fort Worth, US | 17 |
| UFESlocation not on record | 17 |
| Campo Grande, BR | 17 |
| Awka, NG | 16 |
| Charleston Southern Universitylocation not on record | 16 |
| Seoul, KR | 15 |
| UFMSlocation not on record | 14 |
| Ischia Marine Centrelocation not on record | 13 |
| Laboratorio de Ictiologialocation not on record | 13 |
| University of Southern Mississippilocation not on record | 13 |
| Nanjing, CN | 13 |
| Williamsburg, US | 13 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 13 |
| UFBAlocation not on record | 12 |
| TAIElocation not on record | 12 |
| Fayetteville, US | 11 |
| Valdosta State Universitylocation not on record | 11 |
| AUAlocation not on record | 11 |
| IAPlocation not on record | 10 |
| Kew, GB | 9 |
| Rotorua, NZ | 9 |
| Chengdu, CN | 9 |
| Hunan Hupingshan National Nature Reservelocation not on record | 9 |
| EL PASO, US | 9 |
| Strecker Museum, Baylor Universitylocation not on record | 8 |
| UEMlocation not on record | 8 |
| Riverside, US | 8 |
| UFPElocation not on record | 8 |
| Paleontological Collectionlocation not on record | 8 |
| Chongqing Museumlocation not on record | 8 |
| Feira de Santana, BR | 8 |
| South Kensington, GB | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| Norfolk, US | 7 |
| Henderson State Universitylocation not on record | 7 |
| University of Stellenboschlocation not on record | 7 |
| Odawara, JP | 7 |
| Edmonton, CA | 7 |
| Hangzhou, CN | 7 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 7 |
| GAlocation not on record | 6 |
| Bando, JP | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Cruz das Almas, BR | 6 |
| UFRRJlocation not on record | 6 |
| Yangling, CN | 6 |
| Corrientes, AR | 6 |
| Chongqing, CN | 5 |
| Little Rock, US | 5 |
| Wellington, NZ | 5 |
| Xinxiang, CN | 5 |
| Université de Bordeauxlocation not on record | 5 |
| UFRPElocation not on record | 5 |
| Wuhan, CN | 5 |
| Guilin, CN | 5 |
| Instituto do Meio Ambientelocation not on record | 4 |
| Davis, US | 4 |
| Wuhan, CN | 4 |
| Guiyang, CN | 4 |
| Valparaiso, CL | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| JBRJlocation not on record | 4 |
| FUVATESlocation not on record | 4 |
| Guangzhou, CN | 4 |
| Chicago, US | 4 |
| Criciúma, BR | 4 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 4 |
| Chaguaramas, TT | 4 |
| UNESClocation not on record | 4 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 4 |
| San Diego, US | 4 |
| Clemson, US | 4 |
| UFERSAlocation not on record | 3 |
| Universidade da Região de Joinville - Univillelocation not on record | 3 |
| nlocation not on record | 3 |
| BClocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| UnBlocation not on record | 3 |
| Palmerston, AU | 3 |
| Bloomington, US | 3 |
| Ilhéus, BR | 3 |
| Santa Barbara, US | 3 |
| Museo universitario di Chietilocation not on record | 3 |
| Kunming, CN | 3 |
| IECOSlocation not on record | 3 |
| Londrina, BR | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 3 |
| Mississippi State, US | 3 |
| Universidade Federal de Juiz de Foralocation not on record | 3 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 3 |
| Xiamen, CN | 3 |
| Minia, EG | 3 |
| València, ES | 3 |
| Burlington, US | 3 |
| Claremont, US | 3 |
| Beijing, CN | 2 |
| Changsha, CN | 2 |
| Lake Charles, US | 2 |
| San Angelo, US | 2 |
| UNIVILLElocation not on record | 2 |
| CASlocation not on record | 2 |
| Pretoria, ZA | 2 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 2 |
| Brasília, BR | 2 |
| Salvador, BR | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Turlock, US | 2 |
| BDBClocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Taipei, TW | 2 |
| UFPRlocation not on record | 2 |
| Hobart, AU | 2 |
| Masindi, UG | 2 |
| Pelotas, BR | 2 |
| Madrid, ES | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Madrid, ES | 2 |
| Wuzhou, CN | 2 |
| Dover, US | 2 |
| Sagamihara, JP | 2 |
| Buenos Aires, AR | 2 |
| CEPLAClocation not on record | 2 |
| Appalachian State Universitylocation not on record | 2 |
| Kensington, AU | 2 |
| UFSClocation not on record | 2 |
| Adelaide, AU | 2 |
| Moscow State Universitylocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Irvine, US | 1 |
| Badajoz, ES | 1 |
| Central China Agricultural Universitylocation not on record | 1 |
| Maringá, BR | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| Sichuan Agricultural Universitylocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| La Paz, BO | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| JP | 1 |
| Barcelona, ES | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| JGSlocation not on record | 1 |
| Oskarshamn, SE | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Osaka, JP | 1 |
| UFMGlocation not on record | 1 |
| Provo, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Wollongong, AU | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Shanghai, CN | 1 |
| College Park, US | 1 |
| Zhuzhou, CN | 1 |
| Mérida, MX | 1 |
| UNICAMPlocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Long Beach, US | 1 |
| UERJlocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Armidale, AU | 1 |
| Pittsburg, US | 1 |
| Dekalb, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Durham, US | 1 |
| San Luis Obispo, US | 1 |
| Vanderbilt Universitylocation not on record | 1 |
| Pamplona, ES | 1 |
| CPPSULlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Green Bay, US | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| UEMAlocation not on record | 1 |
| Fullerton, US | 1 |
| Lubbock, US | 1 |
| Chadron, US | 1 |
| Castelar, AR | 1 |
| MVJBlocation not on record | 1 |
| Stockholm, SE | 1 |
| Universidade Federal do Oeste da Bahialocation not on record | 1 |
| Logan, US | 1 |
| Vitoria, ES | 1 |
| GZUlocation not on record | 1 |
| Fortaleza, BR | 1 |
| HUFDlocation not on record | 1 |
| Boise, US | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Sanda, JP | 1 |
| ASUlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| UFAClocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Batemans Bay, AU | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Durango, US | 1 |
| Lincoln, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
257 institutions · 1 950 of 2 150 vouchered records shown · 197 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA120 detections
Where the DNA of Alternanthera philoxeroides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found120
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 120 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.0 °C 17.2–21.0
Seasonal swing summer↔winter12.3 °C
Max temp (day)25.9 °C 21.6–25.9
Min temp (night)16.1 °C 13.5–16.1
Precipitation167 mm/mo 126–167
Air humidity58.7 % 58.7–61.4
Moisture balance9.90 mm/mo 9.90–39.0
Vapour deficit1,021 Pa 754–1,021
Wind speed4.70 m/s 4.00–4.70
Cloud cover36.6 % 35.6–36.6
CHELSA 1981–2010, ~9 km grid, at location & month of 111 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.