Alternanthera galapagensis

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Alternanthera

At a glance

Occurrence records13

Data sources6

Biological traits8

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Alternanthera galapagensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF13 records

DNA & barcodingNCBIsequences

01Narrative

Alternanthera galapagensis is a species of plant in the family Amaranthaceae. It is endemic to the Galapagos.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternanthera galapagensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSJQ403561.1 ↗583 bp

ACGT

TAGCAGAACAACCCGCGAACAAGTTCATACCATTATACGGGGTTAGGGGTAGCTGGCTGTCCGGTCCCTTCCCTACGTTGGTGGCACCCC …

Alternanthera galapagensis voucher Eliasson & Eliasson 726 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type13 records

Museum / vouchered13

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Puerto Ayora, EC	13

1 institutions · 13 of 13 vouchered records shown