Alternanthera ficoidea

(L.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Alternanthera

At a glance

Occurrence records1 932

Data sources9

Biological traits24

DNA specimens6

eDNA detections17

Sources9 archives

Databases and archives Alternanthera ficoidea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 932 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF1 932 records

Environmental DNA2 datasets · 2 countries17 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 68

01Narrative

Alternanthera tenella é uma planta da família Amaranthaceae. É conhecida como apaga fogo, periquito, corrente e perpétua do campo. É uma espécie invasora, comum em terrenos baldios na região de Maringá.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology2

Leaf size720 mm²

Plant height0.3 m

⚠ sources differ — GIFT: 0.3 m · AusTraits: 1 m

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeself

Life formannual or subshrub

Life spanperennial

Pollination syndromewind

Raunkiær life formchamaephyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 675 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Growth formherb

Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campinarana, Campo Limpo, Campo Rupestre, Carrasco, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Estacional Decidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Vegetação Sobre Afloramentos R

Succulenceno

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alternanthera ficoidea has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections17

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK744132.1 ↗511 bpSri Lanka

ACGT

CGGCACAATAACAAACCCCGGCGTGTTATGCGCCAAGGAACATAAACATAGCTTTGCCAACCCATTGCCCGGGTCCCCGGTGCATTGGCT …

Alternanthera ficoidea cultivar Ornamental sessile joyweed 2 voucher DMB85 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alternanthera ficoidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidydiploid inferred

Chromosome records28–682n range48median68mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 18

2n 681×CCDB · book-fedorov

CCDB · book-fedorov — Pal M. 1964

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 932 records

Wild obs. + sensor1 854

Museum / vouchered71

Cultivated / captive2

Other5

Origin

Native2

Introduced1

Range

Area of Occupancy AOO4 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 001≤1 km 155≤10 km 37>10 km 14

1 207 georeferenced · 647 without coordinates

Open the mapobservation + sensor1 854

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 8≤10 km 3>10 km 1

12 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence71

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	21
Universidade Federal de Juiz de Foralocation not on record	7
Canadian Department of Agriculturelocation not on record	5
Paris, FR	4
Universidade Federal de Sergipe (UFS)location not on record	3
Miami, US	3
Saint Louis, US	2
Campo Grande, BR	2
Durban, ZA	2
Ilhéus, BR	2
MeiseBGlocation not on record	1
University of Stellenboschlocation not on record	1
ASUlocation not on record	1
St. Augustine, TT	1
*unvoucheredlocation not on record	1
Dehra Dun, IN	1
Podgorica, ME	1
Brussel, BE	1
Universidad Tecnológica del Chocó (UTCH)location not on record	1
MAlocation not on record	1
Taipei, TW	1
Berlin, DE	1
Moscow State Universitylocation not on record	1
CEPLAClocation not on record	1

24 institutions · 65 of 71 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Alternanthera ficoidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.0 °C 29.0–29.0

Seasonal swing summer↔winter4.70 °C

Max temp (day)34.2 °C

Min temp (night)23.4 °C

Precipitation20.7 mm/mo

Air humidity51.2 %

Moisture balance-180 mm/mo

Vapour deficit1,951 Pa

Wind speed3.90 m/s

Cloud cover19.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alternanthera ficoidea

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 932 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 932 records