Altenia scriptella

(Hübner, 1796) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Altenia

At a glance

Occurrence records673

Data sources10

Biological traits2

DNA specimens34

eDNA detections33

Sources10 archives

Databases and archives Altenia scriptella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility673 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF673 records

Environmental DNA1 datasets · 7 countries33 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈507 Mbp

01Narrative

Altenia scriptella is a moth of the family Gelechiidae. It is found from most of Europe, to the Volga region, Turkey and the Caucasus.et al. 2010: The gelechiid fauna of the southern Ural Mountains, part II: list of recorded species with taxonomic notes (Lepidoptera: Gelechiidae). Zootaxa, 2367: 1–68. Preview A folded maple leaf Larva The wingspan is 10–15 mm. Adults are on wing from June to July in one generation per year.UKmoths The larvae feed on Acer campestris, Acer pseudoplatanus and Acer platanoides. They in a folded leaf of their host plant. The species overwinters in the pupal stage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altenia scriptella has left across the world's sequence archives.

At a glance

DNA specimens34

BINs3

Marker genes1

eDNA detections33

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

1Cvariable

34Tvariable

64Cvariable

85Tvariable

103Cvariable

127Tvariable

193Cvariable

205Tmostly conserved

206Tvariable

220Tvariable

235Cvariable

271Tvariable

274Cmostly conserved

287Tmostly conserved

340Tmostly conserved

343Cvariable

352Cvariable

368Gmostly conserved

370Amostly conserved

397Tvariable

400Tvariable

472Tvariable

477Gmostly conserved

530Cvariable

565Avariable

616Tmostly conserved

619Avariable

643Cvariable

652Cvariable

CACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATCCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes9

BINs3

Most divergent pair4.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altenia wagneriellasame genus4.9%Xenolechia lindaesame family5.3%Altenia modestasame genus5.3%Teleiopsis laetitiaesame family5.5%Xenolechia aethiopssame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Altenia scriptella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈506 559 004 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Altenia scriptella0.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type673 records

Wild obs. + sensor516

Museum / vouchered148

Other9

Origin

Native1

Range

Area of Occupancy AOO1 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 234≤1 km 118≤10 km 58>10 km 1

411 georeferenced · 105 without coordinates

Open the mapobservation + sensor516

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 35≤1 km 76≤10 km 1

112 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	58
NHMOlocation not on record	18
European Distributed Institute of Taxonomy (EDIT)location not on record	8
Provincia di Livornolocation not on record	7
NTNU-VMlocation not on record	6
DanishLepidopterologicalSocietylocation not on record	5
Salzburg, AT	4
South Kensington, GB	3
Tallinn, EE	2
SLU Artdatabankenlocation not on record	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
ZSMlocation not on record	1
Nijmegen, NL	1
BioFokuslocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
CBDClocation not on record	1
University of Kaiserslauternlocation not on record	1
Radicondoli, IT	1
neflocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1

20 institutions · 124 of 148 vouchered records shown · 24 without an institution code

09Environmental DNA33 detections

Where the DNA of Altenia scriptella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map7 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 10.8–19.2

Seasonal swing summer↔winter19.4 °C

Max temp (day)19.1 °C 15.0–23.1

Min temp (night)9.50 °C 5.10–14.4

Precipitation114 mm/mo 69.7–294

Air humidity59.8 % 57.6–62.9

Moisture balance-2.50 mm/mo -64.6–164

Vapour deficit680 Pa 483–947

Wind speed2.70 m/s 1.50–3.80

Cloud cover36.8 % 31.6–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)