Alstroemeria versicolor

Ruiz & Pav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Alstroemeriaceae/Alstroemeria

At a glance

Occurrence records44

Data sources11

Biological traits15

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Alstroemeria versicolor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF44 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Die Verschiedenfarbige Inkalilie (Alstroemeria versicolor) ist eine Pflanzenart aus der Gattung der Inkalilien (Alstroemeria) in der Familie der Inkaliliengewächse (Alstroemeriaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass9.08 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 000 m

Elevation min200 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Alstroemeria versicolor across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Fatty acyl glycosides of mono- and disaccharides1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
6-Tuliposide A	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstroemeria versicolor has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLJQ404707.1 ↗733 bp

ACGT

ACAGAAACTAAAGCAAGTGCTGGATTCAAAGCCGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACTAAAGATACT …

Alstroemeria versicolor voucher Cultivated plant P1995-5053 (C) ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Alstroemeria versicolor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Tsuchiya, T. & A. Hang. 1989. Cytogenetics in the genus Alstroemeria. Herbertia 45: 163–170.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type44 records

Wild obs. + sensor41

Museum / vouchered2

Fossil1

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 19≤1 km 3≤10 km 2>10 km 3

27 georeferenced · 14 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MAlocation not on record	1
Provincia di Livornolocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Alstroemeria versicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)