Alstroemeria pelegrina

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Alstroemeriaceae/Alstroemeria

At a glance

Occurrence records329

Data sources11

Biological traits34

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Alstroemeria pelegrina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility329 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF329 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT21.6 Gbp

01Narrative

Alstroemeria pelegrina est une espèce de plante à fleurs de la famille des Alstroemeriaceae selon la classification phylogénétique et des Liliaceae selon la classification classique de Cronquist (1981). Cette plante herbacée vivace est originaire d'Amérique du Sud.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length2 mm

Fruit width2 mm

Leaf length max100 mm

Leaf length min30 mm

Leaf width20 mm

Leaf width max35 mm

Leaf width min10 mm

Plant height0.5 m

Plant height max0.6 m

Seed mass25.27 mg

Seed mass max28.87 mg

Seed mass min19.1 mg

Life cycle & reproduction9

Dehiscencedehiscent

Flowering endMay

Flowering startNov

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max100 m

Elevation min0 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Alstroemeria pelegrina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Anthocyanidins2

Fatty acyl glycosides of mono- and disaccharides1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-Dihydroxyphenyl)-3-[3,4,5-trihydroxy-6-[(3,4,5-trihydroxy-6-methyloxan-2-yl)oxymethyl]oxan-2-yl]oxychromenylium-5,6,7-triol	present	LOTUS
6-Hydroxycyanidin 3-rutinoside	present	LOTUS
6-Tuliposide A	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstroemeria pelegrina has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLAJ554229.1 ↗971 bp

ACGT

ATAATATAATAAAGTGAAATATGTCGAAATTTTGGTATAGAATAGCCCCGAATCGAAAGTCAATATCCGATAGTGAGTTGATCAATTAAT …

Alstroemeria pelegrina chloroplast atpB-rbcL intergenic spacer and partial rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, exon 1, specimen voucher Vinnersten 117

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Alstroemeria pelegrina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size21 613 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Alstroemeria pelegrina21.61 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1617×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · chile +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Tsuchiya, T. & A. Hang. 1989. Cytogenetics in the genus Alstroemeria. Herbertia 45: 163–170.

CCDB · ipcn-api-dl — VENKATESWARLU, J. & K. LAKSHMI. 1975. Cytotaxonomical studies in Alstroemeria L. Proc. Indian Sci. Congr. Assoc. 62: 116–117.

CCDB · ipcn-api-dl — Lakshmi, N. 1976. Cytotaxonomic investigations in the genus Alstroemeria L. CIS Chromosome Inform. Serv. 20: 20–21.

CCDB · ipcn-api-dl — Stephens, J. L., T. Tsuchiya & H. Hughes. 1993. Chromosome studies in Alstroemeria pelegrina L. Int. J. Pl. Sci. 154: 565–571.

CCDB · ipcn-api-dl — Buitendijk, J. H. & M. S. RAMANNA. 1996. Giemsa C-banded karyotypes of eight species of Alstroemeria L. and some of their hybrids. Ann. Bot. (London) 78: 449–457.

CCDB · chile — STEPHENS, J., T. TSUCHIYA & H. HUGHES. 1993. Chromosome studies in Alstroemeria pelegrina L. International Journal of Plant Science 154: 565-571.

CCDB · chile — BUITENDIJK, J. & M RAMANNA. 1996. Giemsa C-banded karyotypes of eigth species of Alstroemeria L. and some of their hybrids. Annals of Botany 78: 449-457.

CCDB · chile — BUITENDIJK, J. E. BOON & M. RAMANNA. 1997. Nuclear DNA content in twelve species of Alstroemeria L. and some of their hybrids. Annals of Botany 79: 343-353.

CCDB · chile — BAEZA, C., O. SCHRADER, A. TERRAB, T. STUESSY, M. ROSAS, E. RUIZ, M. NEGRITTO & E. URTUBEY. 2007a. Recuentos cromosomicos en plantas que crecen en Chile. III. Gayana Botanica 64(2): 175-183.

CCDB · chile — BAEZA, M., O. SCHRADER & H. BUDAHN. 2007c. Characterization of geographically isolated accessions in five Alstroemeria L. Species (Chile) using FISH of tamdely repeated DNA sequences and RAPD analysis. Plant Systematics & Evolution 269: 1-14.

CCDB · kew — Buitendijk JH, Boon EJ, Ramanna MS. 1997. Nuclear DNA content in twelve species of Alstroemeria L. and some of their hybrids. Annals of Botany 79: 343-353

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type329 records

Wild obs. + sensor293

Museum / vouchered25

Cultivated / captive11

Origin

Introduced45

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 151≤1 km 76≤10 km 18>10 km 6

251 georeferenced · 42 without coordinates

Open the mapobservation + sensor293

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence25

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	7
Valparaíso, CL	5
Viña del Mar, CL	5
Riverside, US	3
Santa Barbara, US	2
Edinburgh, GB	2
UChlocation not on record	1

7 institutions · 25 of 25 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Alstroemeria pelegrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)