Alstroemeria ligtu

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Alstroemeriaceae/Alstroemeria

At a glance

Occurrence records531

Data sources10

Biological traits18

DNA specimens2

eDNA detections3

Sources10 archives

Databases and archives Alstroemeria ligtu's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF531 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Alstroemeria ligtu est une espèce de plantes à fleurs de la famille des Alstroemeriaceae selon la classification phylogénétique et des Liliaceae selon la classification classique de Cronquist (1981). Plante herbacée vivace originaire du Chili et du Pérou, elle prospère à proximité des ruisseaux.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.6 m

Seed mass17.68 mg

Seed mass max19.1 mg

Seed mass min12.85 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition5 compounds

Compounds documented for Alstroemeria ligtu across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Anthocyanidins2

Fatty acyl glycosides of mono- and disaccharides1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-Dihydroxyphenyl)-3-[3,4,5-trihydroxy-6-[(3,4,5-trihydroxy-6-methyloxan-2-yl)oxymethyl]oxan-2-yl]oxychromenylium-5,6,7-triol	present	LOTUS
6-Hydroxycyanidin 3-rutinoside	present	LOTUS
6-Tuliposide A	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstroemeria ligtu has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSJQ405022.1 ↗658 bp

ACGT

GAGAAGGAAGACCGCGAACCCGTGAACGGAATCTATCTATACCCGGGCGGGGGGGCGGGCCCCCCTCCCGGACCCCGTCCGGCGGGGCCA …

Alstroemeria ligtu subsp. simsii voucher CONC 166179 (CONC) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alstroemeria ligtu carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1617×CCDB · ipcn-api-dl · CCDB · chile · CCDB · kew

CCDB · ipcn-api-dl — Tsuchiya, T. & A. Hang. 1989. Cytogenetics in the genus Alstroemeria. Herbertia 45: 163–170.

CCDB · ipcn-api-dl — Buitendijk, J. H., A. Peters, R. J. Quené & M. S. RAMANNA. 1998. Genome size variation and C-band polymorphism in Alstroemeria aurea, A. ligtu and A. magnifica (Alstroemeriaceae). Pl. Syst. Evol. 212: 87–106.

CCDB · ipcn-api-dl — Baeza, C. M., G. Kottirsch, J. Espejo & R. Reinoso. 2001. Recuento cromosomicos en plantas que crecen en Chile. I. Gayana, Bot. 58(2): 133–137.

CCDB · ipcn-api-dl — Buitendijk, J. H. & M. S. RAMANNA. 1996. Giemsa C-banded karyotypes of eight species of Alstroemeria L. and some of their hybrids. Ann. Bot. (London) 78: 449–457.

CCDB · ipcn-api-dl — Baeza, C. M., O. Schrader, E. Ruiz & M. Negritto. 2006. Análisis comparativo del cariotipo en poblaciones de Alstroemeria ligtu subsp. ligtu y A. ligtu subsp. simsii (Alstroemeriaceae) de Chile. Darwiniana 44(2): 313–318.

CCDB · chile

CCDB · chile — BUITENDIJK, J. & M RAMANNA. 1996. Giemsa C-banded karyotypes of eigth species of Alstroemeria L. and some of their hybrids. Annals of Botany 78: 449-457.

CCDB · chile — BAEZA, C., O. SCHRADER, E. RUIZ & M. NEGRITTO. 2006b. Analisis comparativo del cariotipo en poblaciones de Alstroemeria ligtu subsp. ligtu y A. ligtu subsp. simsii (Alstroemeriaceae) de Chile. Darwiniana 44(2): 313-318.

CCDB · chile — BUITENDIJK, J. E. BOON & M. RAMANNA. 1997. Nuclear DNA content in twelve species of Alstroemeria L. and some of their hybrids. Annals of Botany 79: 343-353.

CCDB · chile — BAEZA, M., O. SCHRADER & H. BUDAHN. 2007c. Characterization of geographically isolated accessions in five Alstroemeria L. Species (Chile) using FISH of tamdely repeated DNA sequences and RAPD analysis. Plant Systematics & Evolution 269: 1-14.

CCDB · chile — BAEZA, C., G. KOTTIRSCH, J. ESPEJO & R. REINOSO. 2001. Recuentos cromosomicos en plantas que crecen en Chile. I. Gayana Botanica 58(2): 133-137.

CCDB · kew — Buitendijk JH, Boon EJ, Ramanna MS. 1997. Nuclear DNA content in twelve species of Alstroemeria L. and some of their hybrids. Annals of Botany 79: 343-353

n 82×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sanz de Cortazar, C. 1948. Observaciones cromosomales en seis especies Chilenas. Agric. Téchn. (Santiago) 8: 28–35.

CCDB · ipcn-api-dl — De Nordenflycht, G. 1981. In Chromosome number reports LXXII. Taxon 30: 696–697.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type531 records

Wild obs. + sensor466

Museum / vouchered63

Cultivated / captive2

Origin

Native7

Range

Area of Occupancy AOO1 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 251≤1 km 71≤10 km 32>10 km 6

360 georeferenced · 106 without coordinates

Open the mapobservation + sensor466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 2>10 km 2

6 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence63

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UChlocation not on record	42
Zürich, CH	2
Wellington, NZ	2
Tampa, US	2
Saint Louis, US	2
Viña del Mar, CL	2
Edinburgh, GB	2
Santa Barbara, US	2
Albuquerque, US	1
Stockholm, SE	1
Christchurch, NZ	1
Auckland, NZ	1
Severin-McDaniel Insect Collectionlocation not on record	1

13 institutions · 61 of 63 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Alstroemeria ligtu was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)