Alstroemeria angustifolia

Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Alstroemeriaceae/Alstroemeria

At a glance

Occurrence records68

Data sources10

Biological traits13

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Alstroemeria angustifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Alstroemeria angustifolia est une espèce de la famille des Alstroemeriaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Alstroemeria angustifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Amarylidaceae alkaloids1

Fatty acyl glycosides of mono- and disaccharides1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Galantamine	present	LOTUS
6-Tuliposide A	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstroemeria angustifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLAY120358.1 ↗1 161 bp

ACGT

GTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAATGACTCCTCAACCT …

Alstroemeria angustifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Alstroemeria angustifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · ipcn-api-dl · CCDB · chile · CCDB · kew

CCDB · ipcn-api-dl — Buitendijk, J. H. & M. S. RAMANNA. 1996. Giemsa C-banded karyotypes of eight species of Alstroemeria L. and some of their hybrids. Ann. Bot. (London) 78: 449–457.

CCDB · chile — BUITENDIJK, J. & M RAMANNA. 1996. Giemsa C-banded karyotypes of eigth species of Alstroemeria L. and some of their hybrids. Annals of Botany 78: 449-457.

CCDB · chile — BUITENDIJK, J. E. BOON & M. RAMANNA. 1997. Nuclear DNA content in twelve species of Alstroemeria L. and some of their hybrids. Annals of Botany 79: 343-353.

CCDB · kew — Buitendijk JH, Boon EJ, Ramanna MS. 1997. Nuclear DNA content in twelve species of Alstroemeria L. and some of their hybrids. Annals of Botany 79: 343-353

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type68 records

Wild obs. + sensor48

Museum / vouchered20

Range

Area of Occupancy AOO232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 22≤1 km 7≤10 km 7

36 georeferenced · 12 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UChlocation not on record	13
Valparaíso, CL	2
Viña del Mar, CL	2
Saint Louis, US	1
Valparaiso, CL	1
Santiago, CL	1

6 institutions · 20 of 20 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Alstroemeria angustifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)