Alstonia venenata

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Alstonia

At a glance

Occurrence records42

Data sources10

Biological traits12

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Alstonia venenata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS37 compounds

Occurrence & distributionGBIF42 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Alstonia venenata is a plant of the family Apocynaceae. It grows as a shrub or small tree in low to mid elevation deciduous forests of India. The bark of the plant and, sometimes, the fruit, are used for medicinal purposes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typewind

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition37 compounds

Compounds documented for Alstonia venenata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aspidosperma type10

Corynanthe type7

Yohimbine-like alkaloids7

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids5

Isoquinoline alkaloids2

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(17R,20alpha,21beta)-1,2-didehydro-1-demethyl-19-hydroxy-21-methyl-18-norajmalan-17-yl acetate	present	LOTUS
(4aR,16aS)-3,4,4a,5,16a,17,18,19-Octahydro-9,21,22,26-tetramethoxy-4,17-dimethyl-2H-1,24:12,15-dietheno-6,10-metheno-16H-pyrido(2',3':17,18)(1,10)dioxacycloeicosino(2,3,4-ij)isoquinoline	present	NPASS
(4aR,16aS)-3,4,4a,5,16a,17,18,19-Octahydro-9,21,26-trimethoxy-4,17-dimethyl-2H-1,24:12,15-dietheno-6,10-metheno-16H-pyrido(2',3':17,18)(1,10)dioxacycloeicosino(2,3,4-ij)isoquinolin-22-ol	present	NPASS
16-epi-Alstovenine	present	LOTUS
16-epi-Venenatine	present	LOTUS
19S-hydroxy-(+)-vincadifformine	present	LOTUS
5-Methoxy-2,3,4,9-tetrahydropyrido[3,4-b]indol-1-one	present	LOTUS
[13-(Hydroxymethyl)-14-methyl-8,15-diazahexacyclo[14.2.1.01,9.02,7.010,15.012,17]nonadeca-2,4,6,8-tetraen-18-yl] acetate	present	LOTUS
Alstolenine	present	LOTUS
Alstovenine	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstonia venenata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON464182.1 ↗659 bpIndia

ACGT

GGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Alstonia venenata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Alstonia venenata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Singh, F. 1982. Exquisite orichids from Western Ghats (India) -- Aerides crispum. Amer. Orchid Soc. Bull. 51: 937–939.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type42 records

Wild obs. + sensor10

Museum / vouchered32

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced · 3 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	12
Tampa, US	6
Santa Barbara, US	4
Dehra Dun, IN	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Chicago, US	1
Kew, GB	1
South Kensington, GB	1
St. Augustine, TT	1
Austin, US	1
Saint Louis, US	1

11 institutions · 31 of 32 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)