Alstonia muelleriana

Domin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Alstonia

At a glance

Occurrence records534

Data sources9

Biological traits40

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Alstonia muelleriana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS · NPASS174 compounds

Occurrence & distributionGBIF534 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Alstonia muelleriana là một loài thực vật có hoa trong họ La bố ma. Loài này được Domin mô tả khoa học đầu tiên năm 1928.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length255 mm

Fruit width7.5 mm

Leaf length90 mm

Leaf mass113 mg

Leaf mass per area93.52 g/m2

Leaf size5 860 mm²

⚠ sources differ — TRY: 5 860 mm² · AusTraits: 2 647 mm²

Leaf width70 mm

Petiole length0.7 cm

Plant height25 m

⚠ sources differ — AusTraits: 25 m · TRY: 20 m

Seed length5.5 mm

Seed mass2.93 mg

Seed mass max2.9 mg

Seed mass min2.9 mg

Seed width1 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timeyyyyynnnyyyy

Life formtree

Life spanperennial

Pollination syndromefly

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate obovate obtriangular

Woodinesswoody

Physiology & chemistry6

Leaf n23.61 mg/g

Leaf p1.53 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.47 mm²/mg

Wood density681 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition174 compounds

Compounds documented for Alstonia muelleriana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Corynanthe type15

Hydrocarbons8

Fatty alcohols7

Dammarane and Protostane triterpenoids7

Cadinane sesquiterpenoids4

Documented compounds174 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	NPASS
(+)-alpha-Muurolene	present	NPASS
(+)-Calarene	present	NPASS
(+)-Schisandrin B	present	NPASS
(-)-alpha-Gurjunene	present	NPASS
(-)-Caryophyllene	present	NPASS
(1R,2R)-1-hydroxypropane-1,2,3-tricarboxylic acid	present	NPASS
(1R,2R,7R,9R,10S)-6-acetyl-1'-methylspiro[4-oxa-12-azatricyclo[7.2.1.02,7]dodec-5-ene-10,3'-indole]-2'-one	present	LOTUS
(1R,2S,5S)-2-ethenyl-2,6,6-trimethyl-1-prop-1-en-2-ylbicyclo[3.2.0]heptane	present	NPASS
(1R,6R,7S)-2,6,8,8-tetramethyltricyclo[5.2.2.01,6]undec-2-ene	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstonia muelleriana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496562.1 ↗566 bpAustralia · 2013

ACGT

CTAAAGCAAGTGTTGGATTCAAAGCTGGCGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCT …

Alstonia muelleriana isolate B14 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type534 records

Wild obs. + sensor99

Museum / vouchered282

Other153

Origin

Native4

Range

Area of Occupancy AOO1 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 54≤1 km 12≤10 km 2>10 km 1

69 georeferenced · 30 without coordinates

Open the mapobservation + sensor99

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 15≤1 km 14≤10 km 99>10 km 40

168 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	78
Brisbane, AU	76
Museo Entomologico de Leonlocation not on record	37
Canberra, AU	30
Paris, FR	8
Kew, GB	7
Honolulu, US	5
Mount Annan, AU	4
Adelaide, AU	4
James Cook Townsvillelocation not on record	3
Palmerston, AU	3
Bronx, US	2
Armidale, AU	2
Saint Louis, US	1
Taipei, TW	1
University of the Sunshine Coastlocation not on record	1
ASUlocation not on record	1

17 institutions · 263 of 282 vouchered records shown · 18 without an institution code

09Environmental DNA2 detections

Where the DNA of Alstonia muelleriana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 15.9–21.2

Seasonal swing summer↔winter13.4 °C

Max temp (day)24.1 °C 20.6–27.6

Min temp (night)13.1 °C 11.5–14.6

Precipitation26.2 mm/mo 17.7–34.8

Air humidity51.7 % 45.1–58.4

Moisture balance-106 mm/mo -135–-76.7

Vapour deficit1,157 Pa 784–1,531

Wind speed3.70 m/s 3.50–3.90

Cloud cover23.7 % 19.2–28.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)