Alstonia boonei

De Wild. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Alstonia

At a glance

Occurrence records980

Data sources12

Biological traits28

DNA specimens22

eDNA detections10

Sources12 archives

Databases and archives Alstonia boonei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility980 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF980 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD · NCBI22 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Alstonia boonei est une espèce de grands arbres à feuilles caduques de la famille des Apocynaceae. Connue sous le nom de « bois de fromage » ou « bois de motif » dans le commerce en anglais ou de emien en français. Principalement il est utilisé en tant que plante médicinale et pour la construction de menuiserie légère.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height30 m

⚠ sources differ — GIFT: 30 m · TRY: 34 m

Plant height max36.58 m

Plant height min9.14 m

Life cycle & reproduction9

Deciduousnessevergreen

⚠ sources differ — TRY: E · GIFT: deciduous

Dispersal typewind

Flowering endvariable

Flowering startvariable

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza type0.000264151

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio18.62 g/g

Leaf c490 mg/g

Leaf dry-matter content (LDMC)233 mg/g

Leaf n26.3 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density322 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Alstonia boonei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids4

Corynanthe type $ Strychnos type3

Branched fatty acids3

Lupane triterpenoids2

Corynanthe type1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
2-Methylpropanoic acid	present	NPASS
2-Piperidone	present	NPASS
3-Methylbutanoic acid	present	NPASS
[(3S,4aR,6aS,6bR,8aR,12aS,14aR,14bS)-4,4,6a,6b,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl] acetate	present	LOTUS
Acetic Acid	present	NPASS
beta-Amyrin	present	LOTUS
Beta-Amyrone	present	LOTUS
CID 11953926	present	LOTUS
Echitamidine	present	LOTUS

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstonia boonei has left across the world's sequence archives.

At a glance

DNA specimens22

Marker genes4

GenBank sequences6

eDNA detections10

Countries5

The DNA barcodea real sequence read deposited for this species

rbcLKC628315.1 ↗651 bpCameroon · 2008

ACGT

AGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGC …

Alstonia boonei voucher PM5095 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLatrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Alstonia boonei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–882n range65median42mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

2n 881×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Laan., F. M. V. 1979. In IOPB chromosome number reports LXV. Taxon 28: 636–637.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type980 records

Wild obs. + sensor365

Museum / vouchered604

Other11

Range

Area of Occupancy AOO1 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 17≤1 km 29≤10 km 8

54 georeferenced · 311 without coordinates

Open the mapobservation + sensor365

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 599 without coordinates

Open the institutions mapphysical evidence604

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LBVlocation not on record	62
BRLUlocation not on record	59
Saint Louis, US	48
Yaoundé, CM	37
MeiseBGlocation not on record	27
WAGlocation not on record	26
Leiden University Medical Centerlocation not on record	21
Kew, GB	20
Herbier National du Gabonlocation not on record	15
CNF-UFHBlocation not on record	9
Forest Herbarium Ibadan (FHI)location not on record	8
Brussels, BE	8
University of Santo Tomas Museumlocation not on record	6
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	6
Bronx, US	4
IFAN Ch. A. Dioplocation not on record	4
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	4
HNBlocation not on record	2
Tampa, US	2
Philadelphia, US	2
Stockholm, SE	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
National Botanical Gardens of Belgiumlocation not on record	2
Universite Libre de Bruxelles, Herbariumlocation not on record	2
Université du Lomélocation not on record	2
Universite Libre de Bruxelleslocation not on record	2
IPHAMETRAlocation not on record	1
CMULlocation not on record	1
Nnamdi Azikiwe University Herbarium (NAUH)location not on record	1
Goucher Collegelocation not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1
Uppsala, SE	1
National Herbarium of São Tomé and Principelocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Port Harcourtlocation not on record	1
Edinburgh, GB	1
UJLOGlocation not on record	1
University of Calabar/Department of Plant and Ecological Studies Herbariumlocation not on record	1

38 institutions · 394 of 604 vouchered records shown · 210 without an institution code

09Environmental DNA10 detections

Where the DNA of Alstonia boonei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 24.0–26.9

Seasonal swing summer↔winter2.80 °C

Max temp (day)29.2 °C 27.7–32.4

Min temp (night)21.8 °C 20.5–22.9

Precipitation99.6 mm/mo 27.1–405

Air humidity67.9 % 58.8–74.7

Moisture balance-43.1 mm/mo -111–296

Vapour deficit1,037 Pa 763–1,510

Wind speed1.30 m/s 0.9–2.90

Cloud cover24.1 % 14.5–53.8

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)