Alstonia angustiloba

Miq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Alstonia

At a glance

Occurrence records178

Data sources8

Biological traits21

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Alstonia angustiloba's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility178 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS150 compounds

Occurrence & distributionGBIF178 records

DNA & barcodingNCBIsequences

01Narrative

Alstonia angustiloba is a tree in the dogbane family Apocynaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height35 m

Plant height max45 m

Seed mass1.8 mg

Seed mass max1.8 mg

Seed mass min1.8 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typewind

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density396 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition150 compounds

Compounds documented for Alstonia angustiloba across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids $ Isoquinoline alkaloids19

Corynanthe type12

Kaurane and Phyllocladane diterpenoids10

Carboline alkaloids8

Simple phenolic acids8

Documented compounds150 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Condylocarpine	present	LOTUS
(+)-Episyringaresinol	present	NPASS
(+)-Syringaresinol	present	NPASS
(+)-Tubotaiwine	present	LOTUS
(-)-Corydalmine	present	NPASS
(-)-Kaur-16-en-19-oic acid	present	NPASS
(-)-Nornuciferine	present	NPASS
(1S)-1-[(4-hydroxy-3-methoxyphenyl)methyl]-6-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-7-ol	present	NPASS
(1S,4R,9R,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyl-tetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS
(1S,4R,9R,10R,13R,14S)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstonia angustiloba has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLLC736064.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACT …

Alstonia angustiloba 3215186 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

08Occurrence & distribution

Record type178 records

Wild obs. + sensor44

Museum / vouchered134

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 16≤1 km 5≤10 km 1>10 km 2

24 georeferenced · 20 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	2
Kew, GB	1
Xiamen, CN	1
Tampa, US	1
Philadelphia, US	1

5 institutions · 6 of 134 vouchered records shown · 128 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)