Alstonia angustifolia

Wall. ex A.DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Alstonia

At a glance

Occurrence records133

Data sources6

Biological traits16

DNA specimens6

eDNA detections3

Sources6 archives

Databases and archives Alstonia angustifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF133 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height30 m

Plant height max10 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density613 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alstonia angustifolia has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG816953.1 ↗502 bpIndonesia

ACGT

CTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAAGAAGCAGGGGCCG …

Alstonia angustifolia voucher KR1132 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type133 records

Wild obs. + sensor9

Museum / vouchered124

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced · 4 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence124

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	5
Kew, GB	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	5
Saint Louis, US	2
ASUlocation not on record	2
Paris, FR	1
Xiamen, CN	1
Claremont, US	1
Smithfield, AU	1

9 institutions · 23 of 124 vouchered records shown · 101 without an institution code

09Environmental DNA3 detections

Where the DNA of Alstonia angustifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)