Alsophila pometaria

(Harris, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Alsophila

At a glance

Occurrence records4 882

Data sources7

Biological traits0

DNA specimens122

eDNA detections121

Sources7 archives

Databases and archives Alsophila pometaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 882 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI121 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics122 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 882 records

Environmental DNA1 datasets · 2 countries121 detections

DNA & barcodingBOLD122 specimens

01Narrative

Alsophila pometaria est une espèce de lépidoptères de la famille des géométridés originaire d'Amérique du Nord. Sous sa forme chenille, elle est appelée Arpenteuse d'automne, elle peut envahir de vastes territoires.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding122 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alsophila pometaria has left across the world's sequence archives.

At a glance

DNA specimens122

BINs1

Marker genes6

eDNA detections121

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus113 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

131Gmostly conserved

220Tmostly conserved

235Tmostly conserved

266Cmostly conserved

277Cmostly conserved

300Gmostly conserved

407Cvariable

468Gmostly conserved

496Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes9

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alsophila aesculariasame genus6.8%Chorodna ugandariasame family7.6%Dasyboarmia hyperdasyssame family7.9%Axiodes ennomariasame family8.1%Glaucina dispersasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S18S28SEF1-alpha

animal barcoderibosomalmarker

08Occurrence & distribution

Record type4 882 records

Wild obs. + sensor3 533

Museum / vouchered1 349

Range

Area of Occupancy AOO7 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 2 081≤1 km 397≤10 km 137>10 km 405

3 020 georeferenced · 513 without coordinates

Open the mapobservation + sensor3 533

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 8≤1 km 146≤10 km 482>10 km 64

700 georeferenced · 649 without coordinates

Open the institutions mapphysical evidence1 349

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	316
St. Paul, US	309
New Haven, US	288
University of California, Davislocation not on record	71
Royal Saskatchewan Museumlocation not on record	68
Cleveland Museum of Natural History, OH (CLEV)location not on record	42
University of Guelph, Centre for Biodiversity Genomicslocation not on record	38
Colorado State Universitylocation not on record	36
University of Alberta Museums (UAM)location not on record	32
Cambridge, US	22
UDlocation not on record	16
Cornell University Insect Collectionlocation not on record	10
OSUClocation not on record	8
SOVTlocation not on record	6
Universidad Católica de Manizaleslocation not on record	5
Blacksburg, US	5
CUlocation not on record	4
Biodiversity Institute of Ontariolocation not on record	4
San Diego, US	3
Centre for Biodiversity Genomicslocation not on record	3
Catholic University of Pekinglocation not on record	3
Decorah, US	1
King Saud Universitylocation not on record	1
Toronto, CA	1
University of Marylandlocation not on record	1

25 institutions · 1 293 of 1 349 vouchered records shown · 56 without an institution code

09Environmental DNA121 detections

Where the DNA of Alsophila pometaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found121

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 121 detections have coordinates

Open the map2 countries0

Temperate mixed forestAgriculturalWetland4. Native GrasslandForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 2.90–18.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.4 °C 6.90–22.6

Min temp (night)7.50 °C 0.1–12.9

Precipitation88.1 mm/mo 74.8–114

Air humidity56.4 % 54.6–62.6

Moisture balance-9.10 mm/mo -39.2–56.5

Vapour deficit667 Pa 283–865

Wind speed3.70 m/s 2.70–4.10

Cloud cover46.0 % 42.1–63.4

CHELSA 1981–2010, ~9 km grid, at location & month of 115 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alsophila pometaria

At a glance

Sources7 archives

At a glance

Record type4 882 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 882 records