Alsophila kermadecensis

(W.R.B.Oliv.) R.M.Tryon · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Cyatheaceae/Alsophila

At a glance

Occurrence records2

Data sources6

Biological traits1

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Alsophila kermadecensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 138

01Narrative

Alsophila kermadecensis, synonym Cyathea kermadecensis, is a species of tree fern endemic to Raoul Island in the Kermadec Islands, where it is locally common in damp, and sometimes drier, forest and scrub. The trunk of this plant is erect, slender, and up to 20 m tall. It is often covered with scars of old stipe-bases. Fronds are tripinnate and up to 4 m in length. The rachis and stipe are both brown in colouration and bear basal scales that are brown, glossy, and often twisted. Sori are borne on either side of the pinnule midvein. They are covered by hood-like indusia. Large and Braggins (2004) note that A. kermadecensis is similar to Alsophila cunninghamii. A. kermadecensis should be cultivated in good humus and provided shade as well as shelter from the wind. Nevertheless, it is a hardy species that will survive full sun and slight frost. The specific epithet kermadecensis refers to the Kermadec Islands. A. kermadecensis is one of two tree fern species endemic to the islands, the other being Alsophila milnei.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatewet tropical

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alsophila kermadecensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKR153993.1 ↗1 269 bpNew Zealand

ACGT

AGCTGGTGTTAAAGATTATCGATTGACCTATTACACTCCCAAGTATGAGACCAAAGACACCGATATCTTGGCAGCCTTTCGAATGACCCC …

Cyathea kermadecensis voucher WELT:P027384 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Alsophila kermadecensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 138 n = 69

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1381×CCDB · new-zealand40

CCDB · new-zealand40

07Deep time~8.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin8.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	2

1 institutions · 2 of 2 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)