Alsophila japonensis

(Warren, 1894) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Alsophila

At a glance

Occurrence records184

Data sources7

Biological traits0

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Alsophila japonensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility184 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF184 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Alsophila japonensis is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1894 door Warren.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alsophila japonensis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes2

eDNA detections10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P897 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

15Gmostly conserved

33Amostly conserved

42Amostly conserved

153Amostly conserved

159Tmostly conserved

177Tmostly conserved

213Cvariable

228Tmostly conserved

229Tmostly conserved

231Amostly conserved

249Amostly conserved

258Amostly conserved

270Amostly conserved

279Tmostly conserved

282Tmostly conserved

285Amostly conserved

294Tmostly conserved

297Tmostly conserved

333Cmostly conserved

342Amostly conserved

343Tmostly conserved

420Cmostly conserved

429Tmostly conserved

441Tmostly conserved

456Amostly conserved

462Amostly conserved

471Cmostly conserved

490Tmostly conserved

492Avariable

495Avariable

498Avariable

504Tmostly conserved

513Tmostly conserved

528Amostly conserved

531Tmostly conserved

538Cmostly conserved

573Gmostly conserved

612Amostly conserved

637Tmostly conserved

663Tmostly conserved

672Tmostly conserved

690Amostly conserved

711Tmostly conserved

735Tmostly conserved

741Tmostly conserved

765Tmostly conserved

813Gmostly conserved

834Tmostly conserved

876Tmostly conserved

879Tmostly conserved

894Tmostly conserved

TTAATTCGAGCTGAGTTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BINs2

Most divergent pair5.5%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tephronia mosessame family5.2%Inurois viidaleppisame family5.9%Inurois tenuissame family6.0%Inurois nikkoensissame family6.1%Inurois brunneussame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type184 records

Wild obs. + sensor56

Museum / vouchered128

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 22≤1 km 17≤10 km 5>10 km 6

50 georeferenced · 6 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 8≤1 km 8≤10 km 1

17 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kawasaki Shi Tama Ku, JP	25
Toyota city nature sanctuarylocation not on record	22
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	16
Chiba, JP	15
Bando, JP	10
Tartu, EE	9
KIRMlocation not on record	8
Hiwa Museum of Natural Historylocation not on record	7
Itami Shi, JP	6
JP	4
Iwate Prefectural Museumlocation not on record	4
NSMKlocation not on record	1
National Institute for Agro-Environmental Scienceslocation not on record	1

13 institutions · 128 of 128 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Alsophila japonensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)