Alsophila ferdinandii — The Life Data

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Cyatheaceae/Alsophila

At a glance

Occurrence records0

Data sources5

Biological traits7

DNA specimens0

eDNA detections2

Sources5 archives

Databases and archives Alsophila ferdinandii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Alsophila ferdinandii, synonym Cyathea macarthurii, is a fern in the family Cyatheaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max4 m

Life cycle & reproduction1

Life formtree

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alsophila ferdinandii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLJF950806.1 ↗583 bp

ACGT

ACATTACTTAAACGCTACTGCAGCTACGTGTGAAGAAATGATGAAAAGGGCCCGTTTTGCTAGAGAATTGGGGGCACCAATTGTAATGCA …

Cyathea macarthurii voucher NSW:Papadopulos AP788 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL4

plant barcode

09Environmental DNA2 detections

Where the DNA of Alsophila ferdinandii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.