Alsophila cinerea — The Life Data

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Cyatheaceae/Alsophila

At a glance

Occurrence records0

Data sources4

Biological traits1

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Alsophila cinerea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

DNA & barcodingNCBIsequences

01Narrative

Alsophila cinerea, synonym Cyathea cinerea, is a species of tree fern endemic to Mindanao in the Philippines, where it grows in forest at an altitude of about 1000 m. The trunk is erect, up to 5 m tall and about 12 cm in diameter. Fronds are bi- or tripinnate and 1–2 m long. The stipe has long spines and scattered scales, which are either narrow and pale or wide and brown. Sori occur near the midvein of fertile pinnules and are covered by brown indusia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatewet tropical

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alsophila cinerea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPP559947.1 ↗950 bpPhilippines

ACGT

AAGCTGGTGTTAAAGATTATCGATTGACCTATTACACTCCCAAGTATGAGACCAAAGACACCGATATCTTGGCAGCCTTTCGAATGACCC …

Alsophila cinerea voucher TAIF:Wade3893 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode