Alsophila australis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Cyatheaceae/Alsophila

At a glance

Occurrence records39

Data sources6

Biological traits15

DNA specimens0

eDNA detections2

Sources6 archives

Databases and archives Alsophila australis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Occurrence & distributionGBIF39 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Alsophila australis, synonym Cyathea australis, also known as the rough tree fern, is a species of tree fern native to southeastern Queensland, New South Wales and southern Victoria in Australia, as well as Tasmania and Norfolk Island. It was known by the aboriginal people of Illawarra as beeow-wang, as pooeet at Corranderrk Station in Victoria, and as nanga-nanga in Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology5

Leaf length max3 000 mm

Leaf length min2 000 mm

Plant height12 m

Plant height max20 m

Plant height min2.5 m

Life cycle & reproduction2

Deciduousnessevergreen

Life formtree

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alsophila australis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL536435.1 ↗428 bpUSA · 2019

ACGT

TGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAACTTGCGCCCGCGGCTCGTCCAAGGGCATGCCTGCCTGAGCGTCCTCACGACCC …

Cyathea australis voucher MO:Carlsen3455 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type39 records

Museum / vouchered39

Range

Area of Occupancy AOO100 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 6≤10 km 3>10 km 5

14 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence39

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	9
Kew, GB	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
University of Stellenboschlocation not on record	3
Miami, US	3
Santiago de Compostela, ES	3
Bronx, US	2
Long Beach, US	2
Santa Barbara, US	2
Madrid, ES	1
San Jose, US	1
MAlocation not on record	1
WTUlocation not on record	1
Entomological Society of Latvialocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Appalachian State Universitylocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

17 institutions · 39 of 39 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Alsophila australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.5 °C

Min temp (night)8.70 °C

Precipitation114 mm/mo

Air humidity54.5 %

Moisture balance0.9 mm/mo

Vapour deficit709 Pa

Wind speed4.00 m/s

Cloud cover44.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)