Alseuosmia quercifolia

A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Alseuosmiaceae/Alseuosmia

At a glance

Occurrence records894

Data sources8

Biological traits3

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Alseuosmia quercifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility894 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF894 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Alseuosmia quercifolia, commonly known as oak-leaved toropapa, toropapa, and karapapa (Māori), is a species of plant in the family Alseuosmiaceae. It grows as a shrub, reaching a height of 2.5 m, and has variably shaped glossy green leaves. Flowering begins in spring (in the southern hemisphere), producing fragrant pink flowers which become red berries in Autumn. Endemic to New Zealand, it is found only in the upper half of the North Island - predominately in the Waikato region. Currently classified as "Not threatened" by the NZTCS, it was first described in 1839 by Allan Cunningham, before being demoted to a hybrid by Rhys Gardner in 1978 and then reinstated by M. F. Merrett and B. D. Clarkson in 2000.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formshrub

Habitat & environment1

Climatesubtropical

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alseuosmia quercifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU331128.1 ↗737 bpNew Zealand

ACGT

GGCGGTTCGCCGCCGGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Alseuosmia quercifolia voucher AK252827 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alseuosmia quercifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · new-zealand

CCDB · new-zealand

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type894 records

Wild obs. + sensor441

Museum / vouchered453

Range

Area of Occupancy AOO1 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 301≤1 km 54≤10 km 15>10 km 16

386 georeferenced · 55 without coordinates

Open the mapobservation + sensor441

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 19≤1 km 7≤10 km 7

33 georeferenced · 420 without coordinates

Open the institutions mapphysical evidence453

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	278
Wellington, NZ	132
Christchurch, NZ	27
Rotorua, NZ	12
Hobart, AU	1
Museo Entomologico de Leonlocation not on record	1
Chicago, US	1

7 institutions · 452 of 453 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Alseuosmia quercifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)