Alseuosmia macrophylla

A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Alseuosmiaceae/Alseuosmia

At a glance

Occurrence records2 708

Data sources11

Biological traits22

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Alseuosmia macrophylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 708 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF2 708 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Alseuosmia macrophylla, the toropapa or karapapa, is a plant species in the family Alseuosmiaceae. This is a small evergreen shrub which is endemic to New Zealand, along with two closely related species.Thomas Frederick Cheeseman. 1906 An example occurrence of A. macrophylla is in the North Island habitat of the Hamilton Ecological District, where Blechnum discolor and Blechnum filiforme are understory elements with Nothofagus truncata and rimu overstory.C. Michael Hogan. 2009 This plant is known for the pleasant scent of its flowers, and its family name translates as "perfumed grove". The small red berries of toropapa are edible and sweet tasting.Andrew Crowe. Which native forest plant? p39. As a forest understory plant, toropapa will not tolerate full sunlight or frost, and needs its roots to stay moist and cool, however so long as these conditions are met it is reasonably hardy, and is sometimes cultivated as a garden plant.Fiona Eadie. 100 best native plants for New Zealand gardens. p113-115.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length10 mm

Fruit width6 mm

Leaf length max200 mm

Plant height1.5 m

Plant height max2 m

Seed mass4.1 mg

Seed mass max4.1 mg

Seed mass min4.1 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Habitat & environment4

Climatesubtropical

Growth formtree

Habitat GIFTLowland

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alseuosmia macrophylla has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU331126.1 ↗737 bpNew Zealand

ACGT

GGCGGTTCGCCGCCGGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Alseuosmia macrophylla voucher AK252825 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alseuosmia macrophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · new-zealand

CCDB · new-zealand

n 91×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Gardner & Rattenbury 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~14 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin14 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type2 708 records

Wild obs. + sensor2 333

Museum / vouchered375

Origin

Native1

Range

Area of Occupancy AOO4 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 734≤1 km 334≤10 km 68>10 km 22

2 158 georeferenced · 175 without coordinates

Open the mapobservation + sensor2 333

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 3≤1 km 5≤10 km 11>10 km 2

21 georeferenced · 354 without coordinates

Open the institutions mapphysical evidence375

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	177
Wellington, NZ	116
Christchurch, NZ	36
Rotorua, NZ	22
Hobart, AU	6
Armidale, AU	4
EL PASO, US	1
Museo Entomologico de Leonlocation not on record	1
Chicago, US	1
Mount Annan, AU	1
MeiseBGlocation not on record	1
HAWlocation not on record	1
Honolulu, US	1

13 institutions · 368 of 375 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Alseuosmia macrophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alseuosmia macrophylla

At a glance

Sources11 archives

Size & morphology8

Life cycle & reproduction8

Habitat & environment4

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type2 708 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 708 records