Alseodaphne perakensis

(Gamble) Kosterm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Alseodaphne

At a glance

Occurrence records9

Data sources9

Biological traits7

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Alseodaphne perakensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS · NPASS21 compounds

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Alseodaphne perakensis là loài thực vật có hoa trong họ Nguyệt quế. Loài này được (Gamble) Kosterm. miêu tả khoa học đầu tiên năm 1952.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max12 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition21 compounds

Compounds documented for Alseodaphne perakensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Carboline alkaloids4

Aporphine alkaloids $ Isoquinoline alkaloids3

Acridone alkaloids3

Quinazoline alkaloids2

Quinoline alkaloids1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
11-Indolo[3,2-b]quinolin-10-yl-5-methylindolo[3,2-b]quinoline	present	NPASS
2-[(6aS)-2,9-dihydroxy-1,10-dimethoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-6-yl]acetonitrile	present	LOTUS
5,10-Dihydroindolo[3,2-b]quinolin-11-one	present	NPASS
5-Methyl-10,12-dihydroindolo[3,2-b][1]benzazepin-11-one	present	NPASS
5-Methyl-11-propan-2-ylindolo[3,2-b]quinoline	present	NPASS
5-Methylindolo[3,2-b]quinoline-11-carboxylic acid	present	NPASS
bis(10H-indolo[3,2-b]quinolin-11-yl)methanone	present	NPASS
Biscryptolepine	present	NPASS
Cryptolepine	present	NPASS
Cryptolepinone	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alseodaphne perakensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKAJ247144.2 ↗2 499 bpMalaysia

ACGT

GTGCGGCTATGGTCTTTTACACATTTTGATGAAGCAACGGATTCGTCCATACCATTGGTAGAGTTTGTAAGACCACGACTGATCCTGAAA …

Alseodaphne perakensis chloroplast partial trnK intron including matK gene for maturase, specimen voucher van Balgooy 2186 (HBG)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type9 records

Museum / vouchered9

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	2
Edinburgh, GB	2
Kew, GB	1

3 institutions · 5 of 9 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Alseodaphne perakensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter0.9 °C

Max temp (day)30.4 °C

Min temp (night)22.0 °C

Precipitation309 mm/mo

Air humidity68.8 %

Moisture balance162 mm/mo

Vapour deficit1,043 Pa

Wind speed0.7 m/s

Cloud cover49.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)