Alpinia officinarum

Hance · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Alpinia

At a glance

Occurrence records80

Data sources14

Biological traits12

DNA specimens37

eDNA detections37

Sources14 archives

Databases and archives Alpinia officinarum's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS254 compounds

Occurrence & distributionGBIF80 records

Environmental DNA1 datasets · 1 countries37 detections

DNA & barcodingBOLD · NCBI37 specimens

Genome at a glanceCCDB · GoaT · NCBI≈2.1 Gbp

01Narrative

Alpinia officinarum, known as lesser galangal, is a plant in the ginger family, cultivated in Southeast Asia. It originated in China, where its name ultimately derives. It can grow 1.5 to 2 m high, with long leaves and reddish-white flowers. The rhizomes, known as galangal, are valued for their sweet spicy flavor and aromatic scent. These are used throughout Asia in curries and perfumes, and were previously used widely in Europe. They are also used as an herbal remedy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1.1 m

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition254 compounds

Compounds documented for Alpinia officinarum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Linear diarylheptanoids84

Cinnamic acids and derivatives17

Flavonols13

Quinoline alkaloids11

Flavones6

Documented compounds254 total

Tissue Source Quantified only

Compound	Amount	Source
STARCH	250,000 ppm	DukesPhytochem
EO	10,000 ppm	DukesPhytochem
GALANGIN	1,000 ppm	DukesPhytochem
KAEMPFERIDE	800 ppm	DukesPhytochem
EUGENOL	400 ppm	DukesPhytochem
5-HYDROXY-7-(4''-HYDROXY-3''-METHOXYPHENYL)-1-PHENYLHEPTAN-3-ONE	367 ppm	DukesPhytochem
5-HYDROXY-1-PHENYL-7-(4''-HYDROXY-3''-METHOXYPHENYL)-HEPTAN-3-ONE	330 ppm	DukesPhytochem
5-HYDROXY-1,7-DIPHENYLHEPTAN-3-ONE	137 ppm	DukesPhytochem
5-METHOXY-1,7-DIPHENYLHEPTAN-3-ONE	110 ppm	DukesPhytochem
5-EPIDIHYDROYASHABUSHIKETOL	65 ppm	DukesPhytochem

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpinia officinarum has left across the world's sequence archives.

At a glance

DNA specimens37

Marker genes4

GenBank sequences10

eDNA detections37

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMF095942.1 ↗229 bp

ACGT

GCATCGTCGCCTTTGCTCCTTGCTCTGTTGGTGCCAAGCGCGGAAATTGGCCCCGTGTGCCCTCGGGCACAGTCGGCTGAAGAGTGGGTA …

Alpinia officinarum isolate KMS0008A01 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Alpinia officinarum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 099 483 378 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alpinia officinarum2.1 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Chen, Z. & S. Chen. 1984. A report on chromosome numbers of Chinese Zingiberaceae. Guihaia 4: 13–18.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type80 records

Wild obs. + sensor9

Museum / vouchered70

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence70

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	13
Guilin, CN	7
Beijing, CN	5
Xiamen, CN	4
Chengdu, CN	4
Chengdu, CN	3
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	3
Seoul, KR	3
Guangzhou, CN	2
Bronx, US	1
Jinghong, CN	1
Chengdu, CN	1
Saint Louis, US	1
Shanghai, CN	1
South China Normal Universitylocation not on record	1
Nanjing, CN	1
Changsha, CN	1
South Kensington, GB	1

18 institutions · 53 of 70 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA37 detections

Where the DNA of Alpinia officinarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)