Alpinia nutans

(L.) Roscoe · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Alpinia

At a glance

Occurrence records55

Data sources11

Biological traits10

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Alpinia nutans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF55 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 48

01Narrative

صوابع الهوانم، هو نبات ينتمي إلى زنجبيلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Alpinia nutans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Fatty alcohols $ Fatty aldehydes2

Cinnamic acids and derivatives2

Chalcones1

Flavanones1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(R)-Pinocembrin	present	LOTUS
(Z)-1,11-Tridecadiene-3,5,7,9-tetrayne	present	NPASS
(Z)-3-Phenyl-2-propen-1-ol	present	NPASS
1,11-Tridecadiene-3,5,7,9-tetrayne	present	NPASS
Cinnamyl acetate	present	NPASS
Flavokawain B	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpinia nutans has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY742369.1 ↗599 bp

ACGT

CGTAGGTGAACCTGCGGAAGGATCATTCTTGAGAGAGCATTGAACGACGGATGGCTGTGAATGTGTCAACGCGCTCCTTTCGCTGCCCCA …

Alpinia nutans 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alpinia nutans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · book-fedorov

CCDB · book-fedorov — Raghavan T. S., Venkatasubban 1943

CCDB · book-fedorov — Chakravarti 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type55 records

Wild obs. + sensor6

Museum / vouchered49

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UEPAlocation not on record	4
UFBAlocation not on record	4
Salvador, BR	4
Paris, FR	3
Ivano-Frankivsk, UA	2
Vancouver, CA	1
Xiamen, CN	1
Museu Paraense Emílio Goeldilocation not on record	1
Canadian Department of Agriculturelocation not on record	1

9 institutions · 21 of 49 vouchered records shown · 28 without an institution code

09Environmental DNA1 detections

Where the DNA of Alpinia nutans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)