Alpinia modesta

F.Muell. ex K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Alpinia

At a glance

Occurrence records265

Data sources6

Biological traits30

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Alpinia modesta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF265 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Alpinia modesta est une espèce de plantes à fleurs du genre Alpinia et de la famille des Zingiberaceae. C'est une plante herbacée vivace endémique du Nord-Est du Queensland en Australie. Elle pousse dans la forêt humide depuis le niveau de la mer jusqu'à une altitude de 1 000 m. Le botaniste allemand, Ferdinand von Müller l'a découverte. La première description en latin par Karl Moritz Schumann fut publiée en 1904 dans le Volume 4, page 318 de Das Pflanzenreich de Adolf Engler.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length12 mm

Fruit width12.5 mm

Leaf length200 mm

Leaf mass51.78 mg

Leaf mass per area26.95 g/m2

Leaf size1 701 mm²

Leaf width32.5 mm

Plant height1.4 m

Seed length4 mm

Seed mass15 mg

Seed mass max15 mg

Seed mass min15 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeynnnnnnnnyyy

Life formrhizomatous geophyte

Life spanperennial

Pollination syndromebee

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf shapelanceolate linear

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpinia modesta has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY742364.1 ↗426 bp

ACGT

TTGTTGAGAGAGCATCGACCAACGGATGGTTGTGAATGTGTCAACGTGCCCCTTTCCTTGGCCCCCATGTCGGCGGCCAACCGGACATAG …

Alpinia modesta 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type265 records

Wild obs. + sensor74

Museum / vouchered163

Other28

Origin

Native8

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 31≤1 km 19≤10 km 4>10 km 2

56 georeferenced · 18 without coordinates

Open the mapobservation + sensor74

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 22≤1 km 25≤10 km 39>10 km 37

123 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	60
Smithfield, AU	57
Canberra, AU	11
Museo Entomologico de Leonlocation not on record	9
Mount Annan, AU	8
Adelaide, AU	3
James Cook Townsvillelocation not on record	1
Hobart, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Edinburgh, GB	1
Australian Tropical Herbariumlocation not on record	1
Palmerston, AU	1
South Kensington, GB	1

13 institutions · 155 of 163 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Alpinia modesta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 22.2–24.9

Seasonal swing summer↔winter13.1 °C

Max temp (day)28.2 °C 28.0–28.4

Min temp (night)18.6 °C 15.7–21.5

Precipitation328 mm/mo 78.1–578

Air humidity55.8 % 45.9–65.7

Moisture balance173 mm/mo -79.5–425

Vapour deficit1,322 Pa 1,081–1,564

Wind speed2.60 m/s 1.50–3.70

Cloud cover38.1 % 22.1–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)