Alpinia malaccensis

(Burm.f.) Roscoe · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Alpinia

At a glance

Occurrence records126

Data sources12

Biological traits18

DNA specimens23

eDNA detections8

Sources12 archives

Databases and archives Alpinia malaccensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionNPASS3 compounds

Occurrence & distributionGBIF126 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceCCDB · GoaT2.1 Gbp

01Narrative

毛瓣山姜（学名：）为姜科山姜属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height4 m

Seed volume68 mm³

Seed volume max68 mm³

Seed volume min68 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition3 compounds

Compounds documented for Alpinia malaccensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Stigmastane steroids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
beta-Sitosterol	present	NPASS
SENIKUGZBXYRQR-IARZGTGTSA-N	present	NPASS
ULZWGIWLPFONIW-ZRBLBEILSA-N	present	NPASS

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpinia malaccensis has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes8

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF076985.1 ↗345 bpIndia

ACGT

TGATGACTTGAGTCTTGACGCAGTTGTGCCAGGGCCTTGTGGCTGAGGTGCTATGGTGTTTCTAAGGGGGGAATTCCCCCTGGGTTGGGG …

Alpinia malaccensis isolate cgbottu41 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★trnL-F★ITS7★ITS2rpoBrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Alpinia malaccensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 141 820 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alpinia malaccensis2.14 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidy4× tetraploid · measured

Chromosome records48–482n range48median48mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 485×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · eflora +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Chen, Z. y., S. j. Chen, X. x. Huang & S. f. Huang. 1988. A report on chromosome numbers on Chinese Zingiberaceae (5). Guihaia 8: 143–147.

CCDB · ipcn-api-dl — Chen, Z. y., S. z. Chen & S. f. Huang. 1983. Report on chromosome numbers of Chinese Zingiberaceae (3) Guangdong Zhiwu Xuehui Huikan (J. Guangdong Bot. Soc.). (1): 27.

CCDB · eflora

CCDB · book-fedorov — Chakravarti 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type126 records

Wild obs. + sensor17

Museum / vouchered108

Cultivated / captive1

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 4≤10 km 1>10 km 1

8 georeferenced · 9 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence108

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	13
Xiamen, CN	5
Auckland, NZ	4
Edinburgh, GB	2
Guilin, CN	1
Paris, FR	1
Kew, GB	1
Universität Göttingenlocation not on record	1
South Kensington, GB	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
Fort Worth, US	1

11 institutions · 31 of 108 vouchered records shown · 77 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Alpinia malaccensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)