Alpinia galanga

(L.) Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Alpinia

At a glance

Occurrence records451

Data sources14

Biological traits14

DNA specimens57

eDNA detections38

Sources14 archives

Databases and archives Alpinia galanga's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility451 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS355 compounds

Occurrence & distributionGBIF451 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD · NCBI57 specimens

Genome at a glanceCCDB · GoaT · NCBI1.9 Gbp

01Narrative

Alpinia galanga, a plant in the ginger family, bears a rhizome used largely as an herb in Unani medicine and as a spice in Arab cuisine and Southeast Asian cookery. It is one of four plants known as "galangal". Its common names include greater galangal, lengkuas, and blue ginger. Its Latin name is Alpinia galanga.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height2 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition355 compounds

Compounds documented for Alpinia galanga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Cinnamic acids and derivatives43

Aminoacids20

Menthane monoterpenoids $ Monocyclic monoterpenoids19

Acyclic monoterpenoids16

Labdane diterpenoids14

Documented compounds355 total

Tissue Source Quantified only

Compound	Amount	Source
MYRCENE	945,100 ppm	DukesPhytochem
WATER	859,000 ppm	DukesPhytochem
CARBOHYDRATES	830,000 ppm	DukesPhytochem
CINNAMIC-ACID-METHYL-ESTER	480,000 ppm	DukesPhytochem
1,8-CINEOL	300,000 ppm	DukesPhytochem
FIBER	220,000 ppm	DukesPhytochem
PROTEIN	71,000 ppm	DukesPhytochem
ASH	71,000 ppm	DukesPhytochem
EO	48,000 ppm	DukesPhytochem

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpinia galanga has left across the world's sequence archives.

At a glance

DNA specimens57

Marker genes9

GenBank sequences10

eDNA detections38

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP708993.1 ↗301 bpIndia · 2024

ACGT

AAGACTTGTTGAGAGTGCATTGAATGATGGATGGTTGCGAATGTGTCAACGTGCCCCTTTCCTTGCCCCATGTTGCTGGGCAATTGATCG …

Alpinia galanga isolate SCRIPCOGAG23 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★trnL-F★ITS7★ITS2rpoBrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Alpinia galanga carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 887 540 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alpinia galanga1.89 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidy4× tetraploid · measured

Chromosome records48–482n range48median48mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 485×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Chen, Z. & S. Chen. 1984. A report on chromosome numbers of Chinese Zingiberaceae. Guihaia 4: 13–18.

CCDB · book-ipcn67-71 — RAMACHANDRAN, K. 1969. Chromosome numbers in Zingiberaceae. Cytologia 34: 213-221.

CCDB · book-fedorov — Raghavan T. S., Venkatasubban 1943

CCDB · book-atlas-flowering-plants — Raghavan & V. 1943 Sp

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type451 records

Wild obs. + sensor145

Museum / vouchered300

Cultivated / captive5

Other1

Origin

Introduced1

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 66≤1 km 16≤10 km 9>10 km 9

100 georeferenced · 45 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 2≤1 km 8≤10 km 9

19 georeferenced · 281 without coordinates

Open the institutions mapphysical evidence300

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	45
Guangzhou, CN	36
Beijing, CN	27
Xiamen, CN	18
Guilin, CN	17
Bronx, US	9
Edinburgh, GB	7
Chengdu, CN	7
Taipei, TW	6
Guangzhou, CN	5
Philadelphia, US	4
Kew, GB	4
Chengdu, CN	3
Denver, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Hangzhou, CN	2
Fujian Institute of Subtropical Botanylocation not on record	2
Chengdu, CN	2
Centre for Medicinal Plants Research-Arya Vaidya Salalocation not on record	1
Taipei, TW	1
Larsen, K.location not on record	1
Auckland, NZ	1
Christchurch, NZ	1
Tampa, US	1
Bloomington, US	1
Seoul, KR	1
Herbarium of South China Botanical Gardenlocation not on record	1
Baroda, IN	1
St. Augustine, TT	1
South China Normal Universitylocation not on record	1
National Institute of Biological Resourceslocation not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1
OTSlocation not on record	1

33 institutions · 214 of 300 vouchered records shown · 84 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA38 detections

Where the DNA of Alpinia galanga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

Hillsidescultivated herb

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 10.0–27.2

Seasonal swing summer↔winter22.8 °C

Max temp (day)22.5 °C 15.7–29.8

Min temp (night)13.4 °C 3.10–24.1

Precipitation127 mm/mo 13.8–372

Air humidity54.5 % 45.7–69.9

Moisture balance2.70 mm/mo -95.2–236

Vapour deficit901 Pa 827–1,230

Wind speed3.60 m/s 1.80–4.50

Cloud cover27.8 % 24.1–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)