Alpinia conchigera

Griff. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Alpinia

At a glance

Occurrence records98

Data sources11

Biological traits15

DNA specimens9

eDNA detections9

Sources11 archives

Databases and archives Alpinia conchigera's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility98 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS63 compounds

Occurrence & distributionGBIF98 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Alpinia conchigera, the lesser alpinia, is a plant species in the genus Alpinia. Cardamomin is a chalconoid isolated from A. conchigera.Blockade of Nuclear Factor-κB Signaling Pathway and Anti-Inflammatory Activity of Cardamomin, a Chalcone Analog from Alpinia conchigera. Jeong-Hyung Lee, Haeng Sun Jung, Phan Minh Giang, Xuejun Jin, Sangku Lee, Phan Tong Son, Dongho Lee, Young-Soo Hong, Kyeong Lee and Jung Joon Lee, JPET, January 2006, vol. 316, no. 1, pp. 271-278,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height1.5 m

Plant height max1.2 m

Seed mass34.92 mg

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.00000518

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition63 compounds

Compounds documented for Alpinia conchigera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Guaiane sesquiterpenoids5

Cinnamic acids and derivatives5

Acyclic monoterpenoids5

Flavonols4

Linear diarylheptanoids4

Documented compounds63 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	LOTUS
(-)-trans-Carveol	present	LOTUS
(1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene	present	LOTUS
(1S,2R,5S,9S,10S,11S,12S,13S)-12-chloro-2,11-dihydroxy-2,11-dimethyl-6-methylidene-8,14-dioxatetracyclo[8.4.0.01,13.05,9]tetradecan-7-one	present	NPASS
(3aS,5aR,6R,9S,9aS,9bS)-6-hydroxy-5a,9-dimethyl-3-methylidene-3a,4,5,6,7,9,9a,9b-octahydrobenzo[g][1]benzofuran-2,8-dione	present	NPASS
(3E,6S)-2,6-dimethylocta-3,7-diene-2,6-diol	present	NPASS
(3R,6S)-2,6-dimethylocta-1,7-diene-3,6-diol	present	NPASS
(4-(1-Acetyloxyprop-2-Enyl)Phenyl) Acetate	present	LOTUS
(4-Prop-2-Enylphenyl) Acetate	present	LOTUS
(4E)-7-(4-hydroxy-3-methoxyphenyl)-1-phenylhept-4-en-3-one	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpinia conchigera has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH424564.1 ↗323 bp

ACGT

GAGGCCTTGTGGTCGAGGGCACGCCTGCTTGGGCGTCATGGCATGTCGCCTTTGCTCCTTGCTTTGTCGGGGGCCAAGCGCGGAAATTGG …

Alpinia conchigera voucher APM030-17 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type98 records

Wild obs. + sensor20

Museum / vouchered76

Cultivated / captive1

Other1

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 3

9 georeferenced · 11 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7>10 km 1

8 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence76

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	17
Kunming, CN	15
Edinburgh, GB	10
Yunnan Universitylocation not on record	3
Beijing, CN	2
Moscow State Universitylocation not on record	2
Kew, GB	2
Southwest Forestry Collegelocation not on record	1
Guangzhou, CN	1
Jinghong, CN	1
C. Niyomdhamlocation not on record	1
3050location not on record	1
Saint Louis, US	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
Servico de Microbiologia e Imunologialocation not on record	1

15 institutions · 59 of 76 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Alpinia conchigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)