Alpinia caerulea

(R.Br.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Alpinia

At a glance

Occurrence records3 398

Data sources10

Biological traits39

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Alpinia caerulea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF3 398 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Alpinia caerulea, commonly known as native ginger or in the case of the subspecies from the Atherton Tableland red back ginger,Domus Nursery - Alpinia 'Atherton' profile is an understorey perennial herb to 3 m, growing under rainforest, gallery forest and wet sclerophyll forest canopy in eastern Australia. Leaves are up to 40 cm long and 3–10 cm wide. The inflorescence is 10–30 cm long.PlantNET, Alpinia caerulea plant profile The blue capsule is globose 1 cm across, with a brittle outer covering containing black seed and white pulp.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology14

Fruit length14 mm

Fruit width10 mm

Leaf length400 mm

Leaf length max15 mm

Leaf length min10 mm

Leaf mass75.62 mg

Leaf mass per area36.07 g/m2

Leaf size24 730 mm²

Leaf width50 mm

Leaf width max100 mm

Plant height1.5 m

⚠ sources differ — GIFT: 1.5 m · AusTraits: 3 m · TRY: 1.55 m

Plant height max3 m

Seed length3.5 mm

Seed mass15.99 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formrhizomatous geophyte

Life spanperennial

Pollination syndromebee

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate oblong

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.41 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpinia caerulea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY742342.1 ↗623 bp

ACGT

CTGCGGAAGGATCATTGTTGAGAGAGCATCGACCAACGGATGGTTGTGAATGTGTCAACGTGCCCCTTTCCTTGGCCCCCATGTCGGCGG …

Alpinia caerulea 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Alpinia caerulea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BISSON, s. ,s. GUILLEMET, & J. - L. HAMEL. 1968. Contribution a l'etude caryo-taxinomique des Scitaminees Mem. Mus. National Hist. Naturelle Ser. B. 18: 59-133.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 398 records

Wild obs. + sensor2 724

Museum / vouchered355

Cultivated / captive6

Other313

Origin

Native41

Range

Area of Occupancy AOO7 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 2 140≤1 km 211≤10 km 41>10 km 62

2 454 georeferenced · 270 without coordinates

Open the mapobservation + sensor2 724

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 57≤1 km 31≤10 km 138>10 km 52

278 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence355

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 2

4 georeferenced · 2 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	112
Smithfield, AU	81
Mount Annan, AU	41
Museo Entomologico de Leonlocation not on record	39
Canberra, AU	28
Armidale, AU	14
John T. Waterhouse Herbariumlocation not on record	8
Auckland, NZ	6
James Cook Townsvillelocation not on record	4
Adelaide, AU	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Edinburgh, GB	2
Saint Louis, US	1
Honolulu, US	1
South Kensington, GB	1
Palmerston, AU	1

17 institutions · 347 of 355 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Alpinia caerulea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alpinia caerulea

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 398 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 398 records