Alphitonia zizyphoides

(Biehler) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Alphitonia

At a glance

Occurrence records209

Data sources11

Biological traits16

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Alphitonia zizyphoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF209 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Alphitonia zizyphoides là một loài thực vật có hoa trong họ Táo. Loài này được A.Gray mô tả khoa học đầu tiên năm 1854.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height20 m

Seed mass26.18 mg

Life cycle & reproduction3

Dispersal typeanimal

Life formtree

Life spanperennial

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Succulenceno

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density450 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition11 compounds

Compounds documented for Alphitonia zizyphoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Dammarane and Protostane triterpenoids4

Lupane triterpenoids2

Glycosyldiacylglycerols1

Phenylethanoids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
2-[2-[[17-(2,3-Dimethylbut-3-enyl)-16-hydroxy-2,6,6,10,16-pentamethyl-18,20-dioxahexacyclo[17.2.1.01,14.02,11.05,10.015,19]docosan-7-yl]oxy]-5-hydroxy-6-(hydroxymethyl)-4-[3,4,5-trihydroxy-6-[(3,4,5-trihydroxyoxan-2-yl)oxymethyl]oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
5-(2-Hydroxyethyl)-2-methoxycyclohexa-1,3,4-triene-1,3-diol	present	LOTUS
[(2S)-1-[(3Z,6Z,9Z,12Z,15Z)-octadeca-3,6,9,12,15-pentaenoyl]oxy-3-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxypropan-2-yl] (6Z,9Z,12Z,15Z)-octadeca-6,9,12,15-tetraenoate	present	NPASS
Alphitol	present	LOTUS
Betulinic Acid	present	LOTUS
IXGDAVSSYHYPJX-GNQOIDSESA-N	present	NPASS
LZUMFOJNPXMVHE-FOAIJFERSA-N	present	NPASS
Zizyphoiside C	present	LOTUS
Zizyphoiside D	present	LOTUS
Zizyphoiside E	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alphitonia zizyphoides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKJ630935.1 ↗834 bpFrance

ACGT

GATCGAGGCGACGTGGGCGGTTCGCTGCCCGCGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAG …

Alphitonia zizyphoides voucher Meyer 3086 (PAP) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type209 records

Wild obs. + sensor29

Museum / vouchered172

Other8

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 1>10 km 4

5 georeferenced · 24 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 1≤1 km 6≤10 km 15>10 km 3

25 georeferenced · 147 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	22
Bronx, US	20
Honolulu, US	15
Museo Entomologico de Leonlocation not on record	10
Auckland, NZ	9
Kew, GB	8
University of Stellenboschlocation not on record	8
Université de Strasbourglocation not on record	8
Wellington, NZ	6
Paris, FR	3
Wlocation not on record	3
Saint Louis, US	2
Moscow State Universitylocation not on record	1
Brisbane, AU	1
Hobart, AU	1
HAWlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Gump Stationlocation not on record	1

18 institutions · 120 of 172 vouchered records shown · 52 without an institution code

09Environmental DNA1 detections

Where the DNA of Alphitonia zizyphoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)