Alphitonia excelsa

(Fenzl) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Alphitonia

At a glance

Occurrence records19 136

Data sources12

Biological traits51

DNA specimens8

eDNA detections6

Sources12 archives

Databases and archives Alphitonia excelsa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources51 traits

Chemical compositionLOTUS · NPASS21 compounds

Occurrence & distributionGBIF19 136 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Alphitonia excelsa, commonly known as the red ash or soap tree, is a species of tree in the family Rhamnaceae. It is endemic to Australia, being found in New South Wales, Queensland, Northern Territory and the northeastern tip of Western Australia. It is used in bush regeneration as a pioneer species and for amenity planting.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology23

Fruit length10 mm

Fruit width10 mm

Leaf length90 mm

Leaf length max140 mm

Leaf length min50 mm

Leaf mass73.25 mg

Leaf mass per area107 g/m2

Leaf size2 475 mm²

⚠ sources differ — TRY: 2 475 mm² · AusTraits: 1 739 mm²

Leaf width29.45 mm

Leaf width max50 mm

Leaf width min20 mm

Petiole length0.8 cm

Plant height20 m

⚠ sources differ — AusTraits: 20 m · TRY: 24.38 m

Plant height max10 m

Plant height min5 m

Seed length5 mm

Seed mass21.15 mg

⚠ sources differ — TRY: 21.15 mg · AusTraits: 18.2 mg · GIFT: 22.06 mg

Seed mass max22.06 mg

Seed mass min22.06 mg

Seed volume4.2 mm³

Seed volume max4.2 mm³

Seed volume min4.2 mm³

Seed width2.3 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyynnnnnnnn

Life formtree

Life spanperennial

Pollination syndromeinsect

Reproductive maturity8 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: savanna

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate narrowly_elliptical narrowly_ovate

Woodinesswoody

Physiology & chemistry8

Leaf c493 mg/g

Leaf dry-matter content (LDMC)836 mg/g

Leaf n16.89 mg/g

Leaf p0.682 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.9 mm²/mg

Wood density560 mg/cm³

03Chemical composition21 compounds

Compounds documented for Alphitonia excelsa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Steroidal alkaloids10

Lupane triterpenoids3

Aurones3

Abeolupane triterpenoids $ Lupane triterpenoids3

Abeolupane triterpenoids1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Buxaminol C	present	NPASS
(1R,2R,5S,8R,9R,10S,13S,14R,15S,16R,18S)-16-hydroxy-1,2,14,17,17-pentamethyl-8-prop-1-en-2-ylpentacyclo[11.7.0.02,10.05,9.014,18]icosane-5,15-dicarboxylic acid	present	LOTUS
(1R,2R,5S,8R,9S,10R,13R,14R,15R,16S,18R)-16-hydroxy-1,2,14,17,17-pentamethyl-8-prop-1-en-2-ylpentacyclo[11.7.0.02,10.05,9.014,18]icosane-5,15-dicarboxylic acid	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9R,10R,11aR,11bR,13aR,13bS)-9,10-dihydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1R,3aS,5aS,5bR,9R,10R,11aR)-9,10-dihydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13b-tetradecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1R,3R,6S,8R,11S,12S,15E,16S)-6-(dimethylamino)-15-ethylidene-7,7,11,12,16-pentamethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-14-one	present	NPASS
(2S)-2-(3,4-Dihydroxybenzyl)-2,4,6-trihydroxy-3(2H)-benzofuranone	present	LOTUS
(alphaS,3S,3aR,9S,10aR,12aR,12bS)-9-(Dimethylamino)-1,2,3,3a,4,7,8,9,10,10a,11,12,12a,12b-tetradecahydro-N,N,alpha,3a,10,10,12b-heptamethylbenzo(4,5)cyclohept(1,2-e)indene-3-methanamine	present	NPASS
31-Demethylbuxaminol	present	NPASS
[(1S,3R,4S,6R,7S,8R,13R,16S,17S,20R)-16-benzamido-7-[(1R)-1-(dimethylamino)ethyl]-13-hydroxy-4,8,17-trimethyl-19-oxapentacyclo[11.6.1.03,11.04,8.017,20]icos-10-en-6-yl] acetate	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alphitonia excelsa has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes6

GenBank sequences7

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ340157.1 ↗608 bp

ACGT

CAGAGCGACCCGCGAACCCGTAAAAACACAACGGGGGGCTCGGGGCCTCAGGCCCCGGGCTCTCTTGGTCGGGGGGTTGCACCCTGTGCC …

Alphitonia excelsa voucher J. Kellermann 103 (MEL) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★rbcLa★ITS3★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type19 136 records

Wild obs. + sensor13 332

Museum / vouchered2 267

Cultivated / captive23

Other3 514

Origin

Native353

Introduced4

Range

Area of Occupancy AOO39 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 9 296≤1 km 759≤10 km 232>10 km 578

10 865 georeferenced · 2 467 without coordinates

Open the mapobservation + sensor13 332

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 464≤1 km 381≤10 km 937>10 km 177

1 959 georeferenced · 308 without coordinates

Open the institutions mapphysical evidence2 267

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy94% within 1 km

≤100 m 7≤1 km 8≤10 km 1

16 georeferenced · 7 without coordinates

Open the mapnot free-living23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	705
Mount Annan, AU	312
Canberra, AU	310
Palmerston, AU	238
Smithfield, AU	213
Museo Entomologico de Leonlocation not on record	171
Armidale, AU	90
Adelaide, AU	65
Kew, GB	39
Hobart, AU	17
Honolulu, US	16
Saint Louis, US	15
NSW Dept of Planning, Industry and Environmentlocation not on record	15
James Cook Townsvillelocation not on record	9
John T. Waterhouse Herbariumlocation not on record	7
Wollongong, AU	6
Batemans Bay, AU	4
Santa Barbara, US	4
Kensington, AU	4
EL PASO, US	2
Xiamen, CN	2
Auckland, NZ	2
Bronx, US	1
Taipei, TW	1
NSW Office of Environment and Heritagelocation not on record	1
Wellington, NZ	1
Taipei, TW	1
University of the Sunshine Coastlocation not on record	1
IPA/SPlocation not on record	1
MAlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Beijing, CN	1
CSIRO, Tropical Forest Research Centrelocation not on record	1
La Trobe Universitylocation not on record	1

34 institutions · 2 258 of 2 267 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Alphitonia excelsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 18.3–22.1

Seasonal swing summer↔winter9.20 °C

Max temp (day)23.4 °C 22.7–27.1

Min temp (night)14.7 °C 14.3–18.9

Precipitation74.2 mm/mo 17.9–130

Air humidity60.4 % 48.3–63.8

Moisture balance-34.6 mm/mo -125–17.2

Vapour deficit950 Pa 762–1,460

Wind speed2.80 m/s 2.40–3.70

Cloud cover25.9 % 20.4–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alphitonia excelsa

At a glance

Sources12 archives

Size & morphology23

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry8

Compound class profile5 classes

Documented compounds21 total

At a glance

Record type19 136 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type19 136 records