Alpheus gracilis

Heller, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records127

Data sources8

Biological traits4

DNA specimens7

eDNA detections4

Sources8 archives

Databases and archives Alpheus gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

OBISOcean Biodiversity Information System40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS127 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD7 specimens

01Narrative

Alpheus gracilis is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort werd in 1861 gepubliceerd door Heller.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max5 m

Depth min0 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus gracilis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs3

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Where individuals differ — all 120 variable positions, in barcode order

1Cmostly conserved

4Amostly conserved

28Amostly conserved

34Gmostly conserved

37Gmostly conserved

46Gmostly conserved

55Gmostly conserved

73Gmostly conserved

76Cmostly conserved

79Gmostly conserved

85Gmostly conserved

97Tmostly conserved

103Cmostly conserved

106Tmostly conserved

109Gmostly conserved

121Amostly conserved

139Amostly conserved

145Gmostly conserved

148Amostly conserved

151Cmostly conserved

157Cmostly conserved

160Gmostly conserved

166Amostly conserved

175Gmostly conserved

178Cmostly conserved

181Gmostly conserved

184Gmostly conserved

187Cmostly conserved

193Tmostly conserved

199Tmostly conserved

205Gmostly conserved

208Avariable

214Gmostly conserved

223Cmostly conserved

235Cmostly conserved

238Amostly conserved

241Tmostly conserved

244Amostly conserved

265Tmostly conserved

268Cmostly conserved

271Amostly conserved

274Gmostly conserved

280Tmostly conserved

283Cmostly conserved

292Amostly conserved

295Gmostly conserved

298Tmostly conserved

304Gmostly conserved

310Gmostly conserved

316Gmostly conserved

319Cmostly conserved

325Avariable

334Cmostly conserved

337Amostly conserved

343Gmostly conserved

346Cmostly conserved

352Amostly conserved

355Cmostly conserved

364Amostly conserved

373Gmostly conserved

376Avariable

382Tmostly conserved

385Cmostly conserved

388Gmostly conserved

391Avariable

397Tmostly conserved

400Tmostly conserved

403Amostly conserved

409Tmostly conserved

421Amostly conserved

427Tmostly conserved

428Tmostly conserved

430Avariable

433Cmostly conserved

442Cmostly conserved

454Gmostly conserved

457Gmostly conserved

460Tmostly conserved

469Amostly conserved

478Gmostly conserved

481Amostly conserved

490Cmostly conserved

496Gmostly conserved

499Amostly conserved

502Cmostly conserved

508Amostly conserved

511Amostly conserved

514Gmostly conserved

517Cmostly conserved

520Cmostly conserved

523Amostly conserved

529Amostly conserved

532Tmostly conserved

535Amostly conserved

538Cmostly conserved

542Cmostly conserved

544Gmostly conserved

553Cmostly conserved

557Cmostly conserved

562Cvariable

565Gmostly conserved

574Gmostly conserved

577Gmostly conserved

580Cmostly conserved

586Gmostly conserved

595Cmostly conserved

598Gmostly conserved

601Cmostly conserved

616Cmostly conserved

619Amostly conserved

622Cmostly conserved

625Cmostly conserved

628Avariable

631Tmostly conserved

640Cmostly conserved

641Cmostly conserved

643Amostly conserved

653Cmostly conserved

655Gmostly conserved

658Cmostly conserved

CACACTATACTTCATCTTCGGGGCCTGAGCCGGGATGGTAGGAACGGCCCTAAGGCTTCTCATCCGAGCAGAGCTCGGGCAACCGGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.6%

Haplotypes3

BINs2

Most divergent pair18.1%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus thomasisame genus17.6%Alpheus pareuchirussame genus17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type127 records

Wild obs. + sensor7

Museum / vouchered120

Range

Area of Occupancy AOO216 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 2 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 4 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 6≤1 km 4≤10 km 3

13 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	37
Honolulu, US	11
Washington, US	7
Stockholm, SE	6
Sydney, AU	5
Western Australian Museumlocation not on record	4
Cambridge, US	2
Museums Victorialocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	2
University of Floridalocation not on record	2
Paris, FR	2
Florida Museum of Natural Historylocation not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Frankfurt am Main	1

14 institutions · 83 of 120 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Alpheus gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

patch reefreef front

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 20.1–23.6

Seasonal swing summer↔winter3.60 °C

Max temp (day)23.8 °C 22.7–25.0

Min temp (night)20.2 °C 18.1–22.4

Precipitation70.6 mm/mo 50.7–90.5

Air humidity65.7 % 59.7–71.8

Vapour deficit915 Pa 663–1,166

Cloud cover33.5 % 33.5–33.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)