Alpheus formosus

Gibbes, 1850 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records633

Data sources6

Biological traits4

DNA specimens18

eDNA detections23

Sources6 archives

Databases and archives Alpheus formosus's data was compiled from.

GBIFGlobal Biodiversity Information Facility465 records↗

OBISOcean Biodiversity Information System168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS633 records

Environmental DNA1 datasets · 3 countries23 detections

DNA & barcodingBOLD18 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max42 m

Depth min0 m

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus formosus has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections23

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

109Amostly conserved

127Tmostly conserved

367Cmostly conserved

386Cmostly conserved

436Cvariable

468Gmostly conserved

481Amostly conserved

TACCTTATACTTTATCTTCGGAGCTTGAGCCGGAATAGTAGGAACAGCCCTTAGACTCTTAATCCGAGCAGAACTTGGTCAACCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus malleatorsame genus15.3%Alpheus thomasisame genus15.8%Alpheus edwardsiisame genus16.3%Alpheus rapacidasame genus16.3%Alpheus pacificussame genus16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type633 records

Wild obs. + sensor68

Museum / vouchered565

Origin

Native21

Range

Area of Occupancy AOO1 084 km²

Depth

0–200 m sunlit122

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18 m · max 61.2 m · 122 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 14≤1 km 4≤10 km 8>10 km 9

35 georeferenced · 33 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 30≤1 km 19≤10 km 15>10 km 14

78 georeferenced · 487 without coordinates

Open the institutions mapphysical evidence565

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	80
FCMMlocation not on record	47
Mexico City, MX	44
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	41
	22
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	21
Texas Cooperative Wildlife Collectionlocation not on record	21
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	18
UM-RSMASlocation not on record	17
Cambridge, US	16
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	16
New Haven, US	12
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	12
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	3
Paris, FR	3
Centro de Investigación y de Estudios Avanzados, Unidad Irapuato, Instituto Politécnico Nacionallocation not on record	2
CASlocation not on record	2
Universidad de Antioquia (UdeA)location not on record	1
Frankfurt am Main	1

19 institutions · 379 of 565 vouchered records shown · 46 without an institution code

09Environmental DNA23 detections

Where the DNA of Alpheus formosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter9.10 °C

Max temp (day)28.0 °C 27.9–28.0

Min temp (night)22.5 °C 21.5–22.5

Precipitation96.6 mm/mo 96.6–155

Air humidity59.5 % 59.5–63.1

Moisture balance-96.7 mm/mo -96.7–25.4

Vapour deficit1,281 Pa 1,157–1,281

Wind speed4.70 m/s 2.80–4.70

Cloud cover29.5 % 29.5–39.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)